Busch Lab

ZMP

nt5c1ba

Ensembl ID:
ENSDARG00000018153
ZFIN ID:
ZDB-GENE-070424-103
Description:
5'-nucleotidase, cytosolic IB a [Source:RefSeq peptide;Acc:NP_001082913]
Human Orthologue:
NT5C1A
Human Description:
5'-nucleotidase, cytosolic IA [Source:HGNC Symbol;Acc:17819]
Mouse Orthologue:
Nt5c1a
Mouse Description:
5'-nucleotidase, cytosolic IA Gene [Source:MGI Symbol;Acc:MGI:2155700]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa35531 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa35531
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018300 Nonsense 295 365 6 6
ENSDART00000143325 Nonsense 323 393 6 6
Genomic Location (Zv9):
Chromosome 13 (position 32676295)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 32322243
GRCz11 13 32452693
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCGAAGTGCTGCCAGCGCTGGGGCCCGCGTCCTGAAGACCCTACGGAGCT[G/A]GGGCCTGGAGGTGGACGAAGCCCTCTTTTTGGCTGGGGCTCCTAAAGGTC
Associated Phenotype:
Not determined