Busch Lab

ZMP

si:dkey-201i6.4

Ensembl ID:
ENSDARG00000018096
ZFIN ID:
ZDB-GENE-100922-72
Human Orthologue:
SCAP
Human Description:
SREBF chaperone [Source:HGNC Symbol;Acc:30634]
Mouse Orthologue:
Scap
Mouse Description:
SREBF chaperone Gene [Source:MGI Symbol;Acc:MGI:2135958]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa484 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28725
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015566 Nonsense 42 1252 2 23
ENSDART00000141130 Nonsense 42 1245 3 23
Genomic Location (Zv9):
Chromosome 16 (position 43739264)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 41123657
GRCz11 16 41073689
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTAATAAAGATTGATTTGTTGTTGTGTGACCATGCTTTCATTTACAGTTA[C/A]CCTCTGCTGAAGCTGCCTCTACCAGGAACGGGGCCTGTGGAGTTCACCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa484
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015566 Essential Splice Site 1075 1252 20 23
ENSDART00000141130 None None 1245 None 23
Genomic Location (Zv9):
Chromosome 16 (position 43766452)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 41150845
GRCz11 16 41100877
KASP Assay ID:
554-0335.1 (used for ordering genotyping assays)
KASP Sequence:
TATATATATATATATATTTATTACAATAGCTTGATAATCTGAAAAGCAAA[G/A]GAAGCAACACTTATATAATAAAGTTTACCTAAAATATTAGGTGCTAACGC
Associated Phenotype:
Not determined