Busch Lab

ZMP

si:dkey-225n3.4

Ensembl ID:
ENSDARG00000018066
ZFIN IDs:
ZDB-GENE-061220-1, ZDB-GENE-091204-98
Human Orthologue:
PTCHD1
Human Description:
patched domain containing 1 [Source:HGNC Symbol;Acc:26392]
Mouse Orthologue:
Ptchd1
Mouse Description:
patched domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2685233]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa32488 Nonsense Available for shipment Available now
sa17881 Nonsense Available for shipment Available now
sa6773 Nonsense Mutation detected in F1 DNA Not yet available
sa3274 Nonsense F2 line generated Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30109
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026599 None None 890 None 3
ENSDART00000137526 Essential Splice Site None 41 2 2
Genomic Location (Zv9):
Chromosome 24 (position 26295174)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 25218620
GRCz11 24 25363571
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTGTAATTTAAATCTGACTTTGTTTCCTTTGAAGTAAATACAGTACTAA[C/T]CAAGTGTCTCTGACCTAGCAGGACCTGATGAGATTCAGCGCTACGCTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32488
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026599 Nonsense 465 890 3 3
ENSDART00000137526 None None 41 None 2
Genomic Location (Zv9):
Chromosome 24 (position 26305553)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 25208241
GRCz11 24 25353192
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGCCCGAGCTGCTGCAGCAGAAGCCAGCATGGTACCGCTTTCTTATGTA[C/A]ACACATTACAACGAGGAGGCCACGGAAGCAGGACCCCTGTGTGCTTATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17881
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026599 Nonsense 549 890 3 3
ENSDART00000137526 None None 41 None 2
Genomic Location (Zv9):
Chromosome 24 (position 26305803)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 25207991
GRCz11 24 25352942
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTAATKTGGTTGCCACAGAAACAAGCACTAKAGCTTATACTCGTGCCCAA[C/T]AGCGGTATTTCAGTAGTTACAGTCCTGTGATCGGCTTCTACATCTATGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6773
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026599 Nonsense 575 890 3 3
ENSDART00000137526 None None 41 None 2
Genomic Location (Zv9):
Chromosome 24 (position 26305881)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 25207913
GRCz11 24 25352864
KASP Assay ID:
554-5076.1 (used for ordering genotyping assays)
KASP Sequence:
TGATCGGCTTCTACATCTATGAGTCGATTGAGTACTGGAACACCAGTGTG[C/T]AAGAGGACCTACTAGAGTACATTAAAGGTTTTGAACGCATTTCCTGRTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3274
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026599 Nonsense 590 890 3 3
ENSDART00000137526 None None 41 None 2
Genomic Location (Zv9):
Chromosome 24 (position 26305928)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 25207866
GRCz11 24 25352817
KASP Assay ID:
554-3178.1 (used for ordering genotyping assays)
KASP Sequence:
GTGCAAGAGGACCTACTAGAGTACATTAAAGGTTTTGAACGCATTTCCTG[G/A]TTCGAGAGTTACCTTAACTATCTTCATGGGCTGAACATCACTACTAGCCT
Associated Phenotype:
Not determined