Busch Lab

ZMP

scn8ab

Ensembl ID:
ENSDARG00000018032
ZFIN ID:
ZDB-GENE-060906-2
Description:
sodium channel, voltage-gated, type VIII, alpha b [Source:RefSeq peptide;Acc:NP_001038648]
Human Orthologue:
SCN8A
Human Description:
sodium channel, voltage gated, type VIII, alpha subunit [Source:HGNC Symbol;Acc:10596]
Mouse Orthologue:
Scn8a
Mouse Description:
sodium channel, voltage-gated, type VIII, alpha Gene [Source:MGI Symbol;Acc:MGI:103169]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa2298 Nonsense Available for shipment Available now
sa8756 Nonsense Mutation detected in F1 DNA Not yet available
sa33913 Nonsense Mutation detected in F1 DNA Not yet available
sa33912 Nonsense Available for shipment Available now
sa20765 Nonsense Available for shipment Available now
sa9145 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa2298
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022761 Nonsense 198 1958 4 26
Genomic Location (Zv9):
Chromosome 6 (position 39389104)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39460704
GRCz11 6 39458240
KASP Assay ID:
554-2723.1 (used for ordering genotyping assays)
KASP Sequence:
CGAGGTTTCTGTATAGACGACTTCACCTTCCTCAGAGACCCCTGGAACTG[G/A]CTGGATTTCATGGTYATCTCTATGGCGTAAGTATGATAATGTYCTGTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8756
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022761 Nonsense 1012 1958 16 26
Genomic Location (Zv9):
Chromosome 6 (position 39349094)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39420694
GRCz11 6 39418230
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CYGAAGAAGAAACCTCTGGAAGATGAAGACAAACCGCTYGATGACATRTA[T/A]GACAAAAAACTGAACTTAATGGGCAACCACACCGGYGTGGAAATCAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33913
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022761 Nonsense 1174 1958 18 26
Genomic Location (Zv9):
Chromosome 6 (position 39340703)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39412303
GRCz11 6 39409839
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACTGGTGGTTTCTGAGGAAAACTTGCTACCTCATTGTTGAGCACAACTG[G/A]TTTGAGACGCTCATCATTTTTATGATTCTTCTCAGCTCTGGAGCTTTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33912
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022761 Nonsense 1310 1958 21 26
Genomic Location (Zv9):
Chromosome 6 (position 39329028)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39400628
GRCz11 6 39398164
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGCTTTGGTGGGTGCCATTCCCTCCATCATGAATGTGCTGTTGGTGTGTT[T/A]GATCTTTTGGCTGATCTTCAGTATTATGGGTGTCAACCTGTTTGCTGGAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3576
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022761 Nonsense 1458 1958 24 26
Genomic Location (Zv9):
Chromosome 6 (position 39327658)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39399258
GRCz11 6 39396794
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCAGTCTTCTTTTGTCCCTTTACTTTGGAGGTCAGGAWATCTTCATGACA[G/T]AAGAACAGAAAAAATACTACAATGCTATGAAGAAACTGGGCYCAAARAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20765
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022761 Nonsense 1554 1958 25 26
Genomic Location (Zv9):
Chromosome 6 (position 39325891)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39397491
GRCz11 6 39395027
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGGCCTTCACTGGCGAGTTCGTCCTGAAACTCTTTGCGCTGCGACACTA[T/G]TATTTCACCAATGGCTGGAATGTCTTTGACTGCGTCGTTGTCATTCTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9145
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022761 Nonsense 1682 1958 26 26
Genomic Location (Zv9):
Chromosome 6 (position 39324138)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39395738
GRCz11 6 39393274
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTTTGGCAACAGCATGATCTGTCTATTCATGATCACCACATCAGCTGGCT[G/A]GGATGGCCTGTTGGCTCCTATCTTGAACTATCCGCCTGACTGCGACCCTA
Associated Phenotype:
Not determined