Busch Lab

ZMP

nkx2.5

Ensembl ID:
ENSDARG00000018004
ZFIN ID:
ZDB-GENE-980526-321
Description:
homeobox protein Nkx-2.5 [Source:RefSeq peptide;Acc:NP_571496]
Human Orthologue:
NKX2-5
Human Description:
NK2 transcription factor related, locus 5 (Drosophila) [Source:HGNC Symbol;Acc:2488]
Mouse Orthologue:
Nkx2-5
Mouse Description:
NK2 transcription factor related, locus 5 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:97350]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28305
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022377 Nonsense 53 314 1 2
Genomic Location (Zv9):
Chromosome 14 (position 25241159)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 23944250
GRCz11 14 24241495
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCTGGACAGCGCCCTTATTCCGACCTCATCTTGCATGCTGTCCACTTTC[A/T]AACAGGAACAGTTCATGGAAATGCCATCCGGATCCTCTCTCTTCAGCGAA
Associated Phenotype:
Not determined