Busch Lab

ZMP

rtdr1

Ensembl ID:
ENSDARG00000017983
ZFIN ID:
ZDB-GENE-081104-375
Description:
Novel protein similar to vertebrate rhabdoid tumor deletion region gene 1 (RTDR1) [Source:UniProtKB/
Human Orthologue:
RTDR1
Human Description:
rhabdoid tumor deletion region gene 1 [Source:HGNC Symbol;Acc:13437]
Mouse Orthologue:
Rtdr1
Mouse Description:
rhabdoid tumor deletion region gene 1 Gene [Source:MGI Symbol;Acc:MGI:1918486]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa45336 Nonsense Mutation detected in F1 DNA Not yet available
sa1690 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2442
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026831 Essential Splice Site 101 340 3 7
ENSDART00000113945 Essential Splice Site 101 225 3 6
Genomic Location (Zv9):
Chromosome 8 (position 46956921)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44590162
GRCz11 8 44584068
KASP Assay ID:
554-3039.1 (used for ordering genotyping assays)
KASP Sequence:
GTCAAAACTACTGAAGTGCTTTATGTGCTTGCTTCACACAGTATGGGAAG[G/A]TGAGKCCTACAAAAACTAAAAARTTCTGCATGTCTATTTTGTAGCATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45336
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026831 Nonsense 124 340 4 7
ENSDART00000113945 Nonsense 124 225 4 6
Genomic Location (Zv9):
Chromosome 8 (position 46960558)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44586525
GRCz11 8 44580431
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACATTGTGGGCCCCCTTGCAAACCTGTTAGATGACCCTGAGATTGCCTG[T/A]CGTAAAAATGTGCACCGGGCACTTAACAGAATTGCTGAATTTCCCTTGGG
Associated Phenotype:
Not determined