Busch Lab

ZMP

ncoa2

Ensembl ID:
ENSDARG00000017929
ZFIN ID:
ZDB-GENE-010406-3
Description:
Nuclear receptor coactivator 2 [Source:UniProtKB/Swiss-Prot;Acc:Q98TW1]
Human Orthologue:
NCOA2
Human Description:
nuclear receptor coactivator 2 [Source:HGNC Symbol;Acc:7669]
Mouse Orthologue:
Ncoa2
Mouse Description:
nuclear receptor coactivator 2 Gene [Source:MGI Symbol;Acc:MGI:1276533]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa24460 Nonsense Available for shipment Available now
sa24461 Nonsense Available for shipment Available now
sa5991 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa24460
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017165 Nonsense 844 1505 12 22
ENSDART00000124181 Nonsense 844 1505 10 20
ENSDART00000124740 Nonsense 844 1505 12 22
Genomic Location (Zv9):
Chromosome 24 (position 14312882)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 14264330
GRCz11 24 14408749
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGACATCCTGCAGATGACAGGAGAGAGCGGAGCTAACATGAGTCCTCAA[C/T]AGCAGAGAGCACTGCAGACTGCAGTCAGCCAACAGAGTGAGTAACACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24461
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017165 Nonsense 1157 1505 17 22
ENSDART00000124181 Nonsense 1157 1505 15 20
ENSDART00000124740 Nonsense 1157 1505 17 22
Genomic Location (Zv9):
Chromosome 24 (position 14325289)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 14276737
GRCz11 24 14421156
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACACGCCAATGCAAGATGCCACTTTCCACGGCTTGCAAGGACAGATGGGA[C/T]AGAGACCCGGATACCCAATGCTCCGAATGCAAGCGAGACCGGGACTCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5991
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017165 Essential Splice Site 1197 1505 17 22
ENSDART00000124181 Essential Splice Site 1197 1505 15 20
ENSDART00000124740 Essential Splice Site 1197 1505 17 22
Genomic Location (Zv9):
Chromosome 24 (position 14325412)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 14276860
GRCz11 24 14421279
KASP Assay ID:
554-3651.1 (used for ordering genotyping assays)
KASP Sequence:
AACCCAATACACTCAGACTGCAGCTTCAGCACAGGCTACAAGCACAGCAG[G/A]TACACTTTCAACACACACACAARAGYCTGAAGGAAGTAGAACAGAAGTGG
Associated Phenotype:
Not determined