Busch Lab

ZMP

rdh1

Ensembl ID:
ENSDARG00000017882
ZFIN ID:
ZDB-GENE-030912-15
Description:
retinol dehydrogenase 1 [Source:RefSeq peptide;Acc:NP_932335]
Human Orthologue:
RDH5
Human Description:
retinol dehydrogenase 5 (11-cis/9-cis) [Source:HGNC Symbol;Acc:9940]
Mouse Orthologue:
Rdh5
Mouse Description:
retinol dehydrogenase 5 Gene [Source:MGI Symbol;Acc:MGI:1201412]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa34767 Nonsense Mutation detected in F1 DNA Not yet available
sa7214 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa34767
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026210 Nonsense 249 327 4 5
Genomic Location (Zv9):
Chromosome 9 (position 49732157)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 48987353
GRCz11 9 48684838
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCTGAAGAAACGCTGGAGTAATCTTCCAGAACAGGTCAGAAGAGACTAC[G/T]GAGACTCCTACCTGCAGGAATGTGAGTACAATCAGATGATGGAGTAATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7214
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026210 Essential Splice Site 255 327 4 5
Genomic Location (Zv9):
Chromosome 9 (position 49732135)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 48987331
GRCz11 9 48684816
KASP Assay ID:
554-4984.1 (used for ordering genotyping assays)
KASP Sequence:
WCTTCCAGAACAGGTCAGAAGAGACTACGGAGACTCCTACCTGCAGGAAT[G/A]TGAGTACAATCAGATGATGGAGYAATGCAAATTCATAAATGTAAACATCA
Associated Phenotype:
Not determined