Busch Lab

ZMP

prkri

Ensembl ID:
ENSDARG00000017874
ZFIN ID:
ZDB-GENE-000831-4
Description:
protein-kinase, interferon-inducible double stranded RNA dependent inhibitor [Source:RefSeq peptide
Human Orthologue:
DNAJC3
Human Description:
DnaJ (Hsp40) homolog, subfamily C, member 3 [Source:HGNC Symbol;Acc:9439]
Mouse Orthologue:
Dnajc3
Mouse Description:
DnaJ (Hsp40) homolog, subfamily C, member 3 Gene [Source:MGI Symbol;Acc:MGI:107373]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa20911 Essential Splice Site Available for shipment Available now
sa20910 Nonsense Available for shipment Available now
sa31565 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26933
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026098 Nonsense 65 500 2 12

The following transcripts of ENSDARG00000017874 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 21962149)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 20552585
GRCz11 7 20792761
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCCGTAAGCTGCTGGCAGCCGGACAGCTGGCCGAGGCCCTGTCTCACTA[T/G]CATTCAGCTGTGGGTAAGACACATACAAGCACACAATCATGGATGAAAAC
Long Flanking Sequence:
AAGATCTTAGCTGGTTAATGTTAAAGCTGAAAGCTTTTGTGAACAAGTACAGATGGACTGACGCTTTTGTAGTTGGGTTTTGTTTTCCAGAAATAACCATGCTCTTGGACAGGGCGCTGTTTGCATGCTTTCACTTTGTGTTGTCTTTGTTAACAGAAACCGAAACCCATTAGAGTGTAATATTATCTTACCTTTAAGAAATGTTGTCACAACATTACAAAAAGAATGCTCATTTTAAGTACTGTTTGTCAGTTTAAGGCTCAGTAATGTATTCATTTCAGGCACAGAGGGTTTTCAAAGCTGCCATAGAATAATTAAAAAAAAATTATTATTAATTCAAATCATTGTAAAATAATCTGAGTGCAGATGTTGTGAGTCAGCTGCCTACCTCTCTGGTTTACAGGTGTGTTAGGAGCCACACCTGTTGAGATCGAGCATCATCTGGAAATGGGCCGTAAGCTGCTGGCAGCCGGACAGCTGGCCGAGGCCCTGTCTCACTA[T/G]CATTCAGCTGTGGGTAAGACACATACAAGCACACAATCATGGATGAAAACTACACTTTAACACTACTACTGACTGGGGTCAGTAAGATACAAAAAACAAATTAATATTTTAAGCTTTATTATAGCATTAAATTGATTATTTTGAAAACATTCAAACTTTTAGAAACCATTTCTATTTTTAATAAAATAATGTTTTGGAATTTTCTATTCATCAAATAATCCTGAAACAATTTTGATGAGCAATAATTCATTATGTCTTAATCACCTTTACATCAGTAATAATTCCTGAAGGATCATCATGTGACACTGACGACTGCCGTTATAATGTATAAAATTCAACTTTGCATTCACAAGATTAAAATGCATTCATTTATTTTGAATATTTTATTCTATATTATAGCTTTGCATTGATATTTAAAACCATGAAGACTATTGGAAACCATTTCCTTTTTAAGTAAATGAATGTTTTTGAAATTTCTGTTCATCAAAGAATCCTGAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20911
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026098 Essential Splice Site 111 500 None 12

The following transcripts of ENSDARG00000017874 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 21960153)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 20550589
GRCz11 7 20790776
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTGCCGGATCTGACCCAAGCCATACAGCTCAAGCCAGACTTTCTTGCTG[T/A]GAGTTCATTTTTGTTGTTGTAATACAAAATTGAGTTCTATGTGGCAAACA
Long Flanking Sequence:
ACATTTTTTATAAAATTACAAATTGACAACAGACAAGCATTATAAACAAAATGTAATGAAAAGTAAAAAAAAAAAAATTCTTTTTTGAGAAATTCTTAAGAATCTGTTATTATGTAAAAAGAACTCCCAAGAATAATAATTGATAATTGTTAATTTGCTAAATCATGCGTTTAATTTTTCCAACATAAACCAAATAGTACAAATGTGTACGAATTGAGCATAAGACAAAAAAAAATTCTCCAAAATTTCTAAAAGTACATTTATTTTTCCATTTCCTTTTTTTTTCCAGATCTGTTTTAGATGCATTTTTGTTTAGACATATTTAATATGCATAATTCAAAGTGAAAATTAGATGTCTAATGTGTCTTAAACAGAGGGCGACTCTAAGAACTATTTGACCTACTACAAACGGGCTACCGTTTTCCTGGCCATGGGCAAATCCAAGTCAGCCCTGCCGGATCTGACCCAAGCCATACAGCTCAAGCCAGACTTTCTTGCTG[T/A]GAGTTCATTTTTGTTGTTGTAATACAAAATTGAGTTCTATGTGGCAAACAGTATATACACATTTATAGTATGCATATGTTTTCAGGCCAGACTGCAGAGGGGTAATATTCTTCTGAAACAAGGAAGTACTCAAGAGGCCAGAGAGGACTTCCAAGCAGTTGTGAGTAAAACCATTCTCTTTTTTCCTAAAGGATAGTTCACACAGAAAGGAAAATTCATCATTTACTCTCCTGCATGTGGTTTTAAGCCTTTACGAGTTTGTCTTCTTTATTTTATTTTATTTTTTTGATAGTATGGACGTTGATCTGTGCCAGCAATCAGCATTCTTTAAAATAGCTTTCTTTAATATATTATTGAAAAAGAAATGATAATGTATGGACTCTTAGTTGGTTCTGAAGATTTACGAGTTTCAAAAGAAACACAAAAGAAGATATTTTAAAGAGTGTTGAGAAACTGATAATCATTGACATCCATAGTAGAAAAACAAATGCTGTGGAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20910
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026098 Nonsense 123 500 4 12

The following transcripts of ENSDARG00000017874 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 21960034)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 20550470
GRCz11 7 20790657
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATGCATATGTTTTCAGGCCAGACTGCAGAGGGGTAATATTCTTCTGAAA[C/T]AAGGAAGTACTCAAGAGGCCAGAGAGGACTTCCAAGCAGTTGTGAGTAAA
Long Flanking Sequence:
AGAACTCCCAAGAATAATAATTGATAATTGTTAATTTGCTAAATCATGCGTTTAATTTTTCCAACATAAACCAAATAGTACAAATGTGTACGAATTGAGCATAAGACAAAAAAAAATTCTCCAAAATTTCTAAAAGTACATTTATTTTTCCATTTCCTTTTTTTTTCCAGATCTGTTTTAGATGCATTTTTGTTTAGACATATTTAATATGCATAATTCAAAGTGAAAATTAGATGTCTAATGTGTCTTAAACAGAGGGCGACTCTAAGAACTATTTGACCTACTACAAACGGGCTACCGTTTTCCTGGCCATGGGCAAATCCAAGTCAGCCCTGCCGGATCTGACCCAAGCCATACAGCTCAAGCCAGACTTTCTTGCTGTGAGTTCATTTTTGTTGTTGTAATACAAAATTGAGTTCTATGTGGCAAACAGTATATACACATTTATAGTATGCATATGTTTTCAGGCCAGACTGCAGAGGGGTAATATTCTTCTGAAA[C/T]AAGGAAGTACTCAAGAGGCCAGAGAGGACTTCCAAGCAGTTGTGAGTAAAACCATTCTCTTTTTTCCTAAAGGATAGTTCACACAGAAAGGAAAATTCATCATTTACTCTCCTGCATGTGGTTTTAAGCCTTTACGAGTTTGTCTTCTTTATTTTATTTTATTTTTTTGATAGTATGGACGTTGATCTGTGCCAGCAATCAGCATTCTTTAAAATAGCTTTCTTTAATATATTATTGAAAAAGAAATGATAATGTATGGACTCTTAGTTGGTTCTGAAGATTTACGAGTTTCAAAAGAAACACAAAAGAAGATATTTTAAAGAGTGTTGAGAAACTGATAATCATTGACATCCATAGTAGAAAAACAAATGCTGTGGAAGTCAGTGGTCACTGGTTACCTTTTGCTTGTTTTCAACAGAAGAAAGAAATCCACACTTGTTTTAAAACATATTTATAGCATGCATTAAAAATTTTCTGTTGGATGTTATGAGCTTATTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31565
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026098 Nonsense 168 500 5 12

The following transcripts of ENSDARG00000017874 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 21959336)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 20549772
GRCz11 7 20789960
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAAGGCTGATAAGCTGGAGTCTCTCCAGGAAGAGGCGCATGAAGCTCAT[C/T]GACGTGGAGACTGCAGGATTGCTGTCCAGGTGCTGGAGCATGTCATAGAG
Long Flanking Sequence:
ATCAGCATTCTTTAAAATAGCTTTCTTTAATATATTATTGAAAAAGAAATGATAATGTATGGACTCTTAGTTGGTTCTGAAGATTTACGAGTTTCAAAAGAAACACAAAAGAAGATATTTTAAAGAGTGTTGAGAAACTGATAATCATTGACATCCATAGTAGAAAAACAAATGCTGTGGAAGTCAGTGGTCACTGGTTACCTTTTGCTTGTTTTCAACAGAAGAAAGAAATCCACACTTGTTTTAAAACATATTTATAGCATGCATTAAAAATTTTCTGTTGGATGTTATGAGCTTATTACAGTAGGTGCAGCTTCCACCTTCATCCTTAAACCAGATCAGGTTGTTGATGTACTCGGAGCTATCCTCTGATTCCTGCCTCATCTGTTAACCTCTCTATTGTGCAGCTGAATCATTCCCCAGATCATGAGGAGGCACATGATCAGCTCCTGAAGGCTGATAAGCTGGAGTCTCTCCAGGAAGAGGCGCATGAAGCTCAT[C/T]GACGTGGAGACTGCAGGATTGCTGTCCAGGTGCTGGAGCATGTCATAGAGGTGAGTTAGTCTGACATCATAATATATAGCAATAGGACTACAAATATTGCAGGAGAAAAGTCACAAAAAGGAGAAATGCATTTTCAAAAACACAGACAGTTGTCTACATTACAGAAATTGCCATAAAAGTGACCAAAAAGATCCAAATAATAACATTGTGAAGACATTCTAAATCCACGTAGTAACATGTAGAGCATCCAATCACATGCCTAATTACCCTAACTTGTCTAGTTACCCTAATTAATCTTAATAAGGCTTTAAATTGCAATTTAAGCTGTAAATCACAGGGTTTATACAGTCATGGAAAACCCGAAAAAGTCATAGACTTTTGACATGGCATTTTCCAGGCCTGGAAAAGTTTTGGGAAAACAGAAAACCCCACACAGTCTTGAAAAAGTCATGGAAATTAGTTTAACAAATGTCTGTATACTTAAAATTATGGCAGCGCAA
Associated Phenotype:
Not determined