Busch Lab

ZMP

chrnb2b

Ensembl ID:
ENSDARG00000017790
ZFIN ID:
ZDB-GENE-070821-3
Human Orthologue:
CHRNB2
Human Description:
cholinergic receptor, nicotinic, beta 2 (neuronal) [Source:HGNC Symbol;Acc:1962]
Mouse Orthologue:
Chrnb2
Mouse Description:
cholinergic receptor, nicotinic, beta polypeptide 2 (neuronal) Gene [Source:MGI Symbol;Acc:MGI:87891

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa17637 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28649
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041625 Nonsense 18 543 2 6
ENSDART00000143043 None None 480 1 4
Genomic Location (Zv9):
Chromosome 16 (position 24830158)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 22734474
GRCz11 16 22649864
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATATGTATGGATATGTATTGATAAATCATGTGTCTCTTCCAGGCGGTTA[T/A]GGGGCAGATACAGAAGAGAGACTGGTGGAGCATCTTCTCAATCCAGCTCA
Long Flanking Sequence:
ACTACTAAAAACATTGATTGTAAAACTACAATTTTCATTTTCTAATTTATATTAATATTTATGAAAGTAATTTAATGCTACTTAGAAAATAAATGTGTATGTGGTATAATAAAATATTAAATTTTATACATATTTGTATTGTATAATCATAATGAAATATAATCACATTCATCATTATTAAAACAATAGGATTTCAATAAATAATACACTTTATTTTACTGCTTAAGGGTTTACAATGCTTCACAGTAATGTTTTCTCCAGTGGTTTACTTATAAAATAACATGAATTTTATTATGACAGACTGTTATATTTCTGTTTCATTCGTCTAATGTGTTCTCCAGAGAGCTTTTGTGTGTTTTGCAGCTGGGCCTCTGGGTTATACAAAAGTACGCAGCAGATGCCACATCCAACAATGCGAATCTTTTTTGGAAAATATGACTTCATGTTTTGGATATGTATGGATATGTATTGATAAATCATGTGTCTCTTCCAGGCGGTTA[T/A]GGGGCAGATACAGAAGAGAGACTGGTGGAGCATCTTCTCAATCCAGCTCACTACAACAAACTGATCCGACCAGCTACTAATGGATCAGAAGTGGTGACAGTGCAGCTGATGGTCTCGCTGGCGCAGCTCATCAGTGTGGTCAGTGGACACCTACACTTTGATTCTCATATTTAAATGCAGAATGAATAATAAAGATCCTCCTTTATGCTCTTTCACCTATTAATTTGCCTGTAGTGTGGAAAATACAATAGCCAGATGTGAATGACAAAGGTCTGCAAGGGTAGAAAGTGGAATTATTGTCTCCCAAATAAAAAAAAATTCTGAACAGTCTTAAATGAGTTGTCCCTCATCCCTCATTAGCCCCTTTCACACATACAGAACCTTTCCGGAAAATTCCATATCCAAAAACATATCCAATGCTTTTAGCATTCGTTGTTTAAACTGACAGACCCTCATTCTCTGAAACTGGATTTATGGTTAAACGAATAAGAAGCCAACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17637
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041625 None None 543 None 6
ENSDART00000143043 Nonsense 12 480 2 4
Genomic Location (Zv9):
Chromosome 16 (position 24835265)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 22739581
GRCz11 16 22654971
KASP Assay ID:
2260-9606.1 (used for ordering genotyping assays)
KASP Sequence:
TTGACATTAAGATGAATGAAAATGCKAATTAAGTCTACCGTGGTTGTTTA[T/A]TTYCAWCTTCAGGAATGGCAGGACTACAGACTAACATGGAGCCCAGAAGA
Long Flanking Sequence:
GTGTGAAAGAAGGCTGTGGATTTGGAGTATATTTCACTTTCATCGTAACCCAGCAACAATTTTTTTGTTTTTAAAAATATGTCTAATAGTTGTCTAAACGTAGTCATCTTGGCTAAAACAATACTGAATATGGGCCGTCAGTGAAAATCTAATAGACATCTAAGAATAGGCTAAAACTAGATCGAATTAACAGAAATGAATGACTGCAAATATAAAGTCTGTTTAATCTGTCTATTTGACGACTAGTTGAGTTTAGTCTTGTTTTAGCAAAGCTGTTTACTTTTAGATGTCTATTAGATGTCTATTAAACACAAAATTGTTTGCTGGGTAGTGTCAAGGATTGACAAAAGGTGTTTTGTCATTAGCATGTGCTGCGAGGTGTTATAACTTCATTACCTGGTAGTAAAACGCATCTTTCTCCACACACAACCCTTCAGAAGTCATCATTTGTTGACATTAAGATGAATGAAAATGCTAATTAAGTCTACCGTGGTTGTTTA[T/A]TTTCATCTTCAGGAATGGCAGGACTACAGACTAACATGGAGCCCAGAAGAGTTTGATGGCATGAAGAAGGTCCGTCTTCCCTCCAAGCATATTTGGCTGCCTGATGTTGTTCTTTATAACAAGTAAGCCTCGAAAGATCATGTTGCTTAGCTTTCTCTACAACTTATCGCTGCTTTATTACATCTGATCCTTTCTTCCTTTCCTCTTTCATCGAAGCGTAGATAACATCTGTGCTTATCAGTCTCCGTCTCATTAGCGGTGTTCCCGTGTCACATTACATGACCTCACTGTAAATAAAGCATGTTCCTGCTCTCTTGCTCTCATGCCGCGTAGTGGAAGATGATTTATATTTAAGCTAATTAAAACAATACTTCCTCCTGTGTTTGTCTTTATGTATCATTGATAAACTGTGTGCAGATAAACACCGCAAAGAAACAGGCCTCAAAGGTTTGAAAATTGTCTCAAAAAAAAAATTCTGTACAGCAGTAATGTTATAGGAA
Associated Phenotype:
Not determined