Busch Lab

ZMP

srrt

Ensembl ID:
ENSDARG00000017762
ZFIN ID:
ZDB-GENE-020419-13
Description:
Serrate RNA effector molecule homolog [Source:UniProtKB/Swiss-Prot;Acc:Q66I22]
Human Orthologue:
SRRT
Human Description:
serrate RNA effector molecule homolog (Arabidopsis) [Source:HGNC Symbol;Acc:24101]
Mouse Orthologue:
Srrt
Mouse Description:
serrate RNA effector molecule homolog (Arabidopsis) Gene [Source:MGI Symbol;Acc:MGI:1933527]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa20334 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20334
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018895 Nonsense 522 896 13 20
Genomic Location (Zv9):
Chromosome 5 (position 4276642)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 3936311
GRCz11 5 4269346
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTATTTCTGGTTGCTGATTCTGTCCTCCTCTGAGCAGCTGCGGGACTGT[G/T]AATTGGCTCCTGGAGTTAATCGTGATTTGGCGCGTCGGGTGCGAAACGTC
Long Flanking Sequence:
TATTAGACTGTGAAGAGACTTTCAACCAGCGTAACAACAAATGCTTCTGAAGACAATCACCTACTGCACTTTTAAGTGGTTATAAGCCTATGAGTTTCTTCTGTTGAACACACACAAAAAAAAAGATTTGAAGAAAGCTGCAAACCTGTAACCATCGATGCAAGTGAGTGGTTGCAGGTTTGCAGCTTTCTTCAAACTATCTTATTTTATGTTCAACAGTAGAAACTCAAGCCAGTTTGGAACAAGTGAAGGAAGACTAATGAACCGAGATGTGAGGGATAATAAAGGGCTAAATTTAAAGGCTAAACATTTGCATCTCTGCGCGCCAGGTTTTTCCGCCGTTGTTGGGTGACCTTTGACAGAGGAGTGAACATCAAAGAGATCTGCTGGAACCTGCAGAACATCCGGGTGAGTTTTAGATTCATCAACATAAACATCTGACTCTTCATCTTTATTTCTGGTTGCTGATTCTGTCCTCCTCTGAGCAGCTGCGGGACTGT[G/T]AATTGGCTCCTGGAGTTAATCGTGATTTGGCGCGTCGGGTGCGAAACGTCAACGGAATCACTCAGCATAAGCAGGTTCTGCGTAACGACATCAAGCTAGCGGCTAAACTGATTCACGCACTGGATGACAGGGAGAAACTCTGGAGCCAGAAACCCAGAGAAGAGACGCCCACTCTAGAGGTACTGTCACTTCAGGGTTTATACAGCTGGGTTTAACAATTAGGACTGCCCATGGCCAGCGTGAGAGATGTTCGGGACAGTAGAGAGAATTGTTACTGGCCTGATCAGGCCAGTGCTGCCTTGTCATACAATTTTAATTTGCCTTTGACTATGTCAATTGCGTGTCTTAGAATCGAGAAACAATTTGTGCTTTTAAGCCTTTGAATGCTACCTTTTCGTAAACACCGTGTTGCTTTTTGGTTCCTTTTATCTGATTGGGCGTTGTGAGCACGTTATTTTTTTCCACAACCTGGTAAAAACCAGTACAGTGAAGAGATGGCC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5278
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018895 Nonsense 646 896 15 20
Genomic Location (Zv9):
Chromosome 5 (position 4271498)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 3931167
GRCz11 5 4264202
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGTGTANNNNNNNNNTTTGTGTTGGTCTTCTCTCAGGTGTTGGACCGTCTCCTCTTTTA[T/A]CTGCGTATTGTACAYTCTATYGACTATTACAACACCTGYGAGTACCCGAG
Long Flanking Sequence:
TTAGACTACAGGTGAACAGTGTAAAGCAGGGGTGTCCAATCTCGGTCCAGGTGGGCCGGTGTCCCTGCAGGGTTTAGCTCCAACTTGCCTCAACACACCTGCCTGGATGTTTCAAGTATACCTAGTAAGACCTTGATTAGCTTGTTCAGGTGTATTTGATTAGGGTTGGAGCTAAAATCTGCAGGACACCGGCCCTCCCGGAACAAGTTTGGTGACCACTGATGTAAAGTGTAGTACAGTATGTTTTGTACAATGATACCTTCAGCTTATCTGTACAGAAGCTAAATTTGGGTGGAAGTAGTTTTACATCATGAACATCATCATCAGTCAAGTGCTCAGTAATAAAATGACCATGATATTTACTTTAGCACACACAGTAACACTCTTATTGCATAGCCTAAAAACTGTAAAATGAAAACTTGTCTTCTTTTGTGTGTACAAGTTTAATGAAGTGTATTTGTGTTGGTCTTCTCTCAGGTGTTGGACCGTCTCCTCTTTTA[T/A]CTGCGTATTGTACACTCTATTGACTATTACAACACCTGCGAGTACCCGAGTGAGGACGAGATGCCGAACCGCTGCGGGATCATCCATGTGCGAGGGCCCATTCCCCCAAACCGCATTACTCTCAGAGAGGGTACGTGCTGCAGTCACTGCTGACCACTTAATATCAAGGTTTCCGCGGGGTCTTACGTCTAAAATTTAAAAATCGAAATTTAAGGGCTTAAATAGTCTTAAATTCACTGTTCTAGGTCTTAAATATTTTTGCACAGGTCTTATTTTTGAGATGTCCATGTAACGCTACATCTAATGCTCATTTAAATGATTTTTTTTGTTGTTGTTGCTTGGTTTTTGTGGTGTTGTAGTTCTTTATTTCACTAGTCCTATTGTAATTCGCGGTATTACAACTACAAAATGGTCAACTGGCACTAGCCAATCAGCTTTCTGTTATTAAACTCTGTGGCAAATGTGGCGTCATCGCGGTGTATGCGGAAGTTCGCGTTGAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3566
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018895 Essential Splice Site 807 896 17 20
Genomic Location (Zv9):
Chromosome 5 (position 4267896)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 3927565
GRCz11 5 4260600
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCATGCATCCCGGAGATGAAACCCCCACCCCATCCAGGCCCAGGACAGGG[T/C]AAAGCATATGGAAATCTGCTGCATTTGGTGCTGAAAGCTGCTGATGTGAA
Long Flanking Sequence:
TATGTTCTTCGCAATTTTGAGGTATTTATGGAAGTAAATCTGCAAAATTACTTCGTTTAAAATAACCTTTAATATTATAATGAATTTATGACATGGAAAAAAATACATAAGACGTAACAGACTTGAACATACGGTTTTGTGGTCCAGGGTCACCTTTTAAATGTAAAATAACTGTCAAATCTACTATGTAAAAGCCAATAAAGCTGATATGGTGATAAATAAATGATACTATTACTAAGCAAAAATTATAAATCCAATTTATTAAGCTTATTATTTTTAGTTTCCAGTTTAGGGAGTAAATCAGTAAAGCTGATTCTACAATCTCTCTCTCTTTCTCTCAAGGGCCCAGAGTTTGTGAGGAAGCACATCCTGAACAAACACGGGGACAAGATTGAGGAAGTAAAGAAAGAGGTGGTGTTTTTCAACAACTTCCTAATGGATGCTAAAAGACCATGCATCCCGGAGATGAAACCCCCACCCCATCCAGGCCCAGGACAGGG[T/C]AAAGCATATGGAAATCTGCTGCATTTGGTGCTGAAAGCTGCTGATGTGAAATGAACATGGAGTTTGCTTTAATTGTTTTAGGAGTGCTGTCACCCGGTGGTCTTCCCTTCCCACCGCAGGGTCCTCAAGGTCTCATGGGTTTTGGTCAGCCCAGACCTCCACTTATGGGTTATGGAGGTGAGTGTTGGCTAAAATAGTGGAATTATTATTCAGGCTGTCTTATTATGCAGGGTCTTAAAGGTCCTGTGAAGTGCTTTAAATGTGCATTTTTTTTTTTTAATTCGATGTTTAAATGTTTATTGTCATTGGTCAGCTGTCAGAAAGCCTCGTAATGTTTGGTGAATTTGTTTATTTGTTTAAAAACCAATTTAAGATAATTAAATTTAATAAAACTATCTTTATCTTTAATAAAACTAATATTTTTAAAACTAAAAAGGTTATGTTTACATAAAACATGACAATGATGCCATCTAGGGTTGGGCATCTAAGCTATAATGCCG
Associated Phenotype:
Not determined