Busch Lab

ZMP

zgc:77033

Ensembl ID:
ENSDARG00000017757
ZFIN ID:
ZDB-GENE-040426-2532
Description:
phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma isoform [Source:RefSeq pepti
Human Orthologue:
PIK3CG
Human Description:
phosphoinositide-3-kinase, catalytic, gamma polypeptide [Source:HGNC Symbol;Acc:8978]
Mouse Orthologue:
Pik3cg
Mouse Description:
phosphoinositide-3-kinase, catalytic, gamma polypeptide Gene [Source:MGI Symbol;Acc:MGI:1353576]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa15462 Nonsense Available for shipment Available now
sa40205 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa15462
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009076 Nonsense 76 1098 2 11
Genomic Location (Zv9):
Chromosome 4 (position 3222471)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 3338273
GRCz11 4 3351600
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTRGACGTRACTGGAAATTGGACGGTAGAGCAGGTGAAGGTTCAGCTTTG[G/A]CACAGAGCGGTAACCTCTAAGTTATGCCCTGAATTTTACCAAAAATACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40205
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009076 Nonsense 725 1098 4 11
Genomic Location (Zv9):
Chromosome 4 (position 3220084)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 3335886
GRCz11 4 3349213
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGCTGTAATACTGGAAGCGTATCTCCGTGGCTGTGGTGAAGAAATGCTA[C/T]AGGACTTCAGGAAGCAGGTGGAGATCACAGAGGCCTTGCAAAAGGTCGCT
Associated Phenotype:
Not determined