Busch Lab

ZMP

si:dkey-52h10.3

Ensembl ID:
ENSDARG00000017742
ZFIN ID:
ZDB-GENE-081104-501
Description:
glutamate receptor, metabotropic [Source:RefSeq peptide;Acc:NP_001116764]
Human Orthologue:
GRM6
Human Description:
glutamate receptor, metabotropic 6 [Source:HGNC Symbol;Acc:4598]
Mouse Orthologue:
Grm6
Mouse Description:
glutamate receptor, metabotropic 6 Gene [Source:MGI Symbol;Acc:MGI:1351343]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa21200 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8307
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013311 Nonsense 13 908 1 10
ENSDART00000138993 Nonsense 13 907 1 10
Genomic Location (Zv9):
Chromosome 8 (position 9077281)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 8493863
GRCz11 8 8532448
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAKTCTTGGTGATTATGACRTCACATCCTCTTCCATTCTCATTGGACCAT[C/T]AGGTCAGGATGTTTCGAGTTTTAAGCTGTACCACCTGTCACGCATCTACR
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21200
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013311 Nonsense 649 908 8 10
ENSDART00000138993 Nonsense 648 907 8 10
Genomic Location (Zv9):
Chromosome 8 (position 9151016)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 8567598
GRCz11 8 8606183
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGGGCCGCAGGCCGAGAGCTCAGCTACGTGCTCCTGACTGGCATCTTCT[T/G]AATTTACCTCATCACCTTCCTCATGATCGCAGAGCCCGGGACTGTCGTGT
Associated Phenotype:
Not determined