Busch Lab

ZMP

zgc:86841

Ensembl ID:
ENSDARG00000017728
ZFIN ID:
ZDB-GENE-040718-430
Description:
prohibitin 2 [Source:RefSeq peptide;Acc:NP_001002681]
Human Orthologue:
PHB2
Human Description:
prohibitin 2 [Source:HGNC Symbol;Acc:30306]
Mouse Orthologue:
Phb2
Mouse Description:
prohibitin 2 Gene [Source:MGI Symbol;Acc:MGI:102520]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa40710 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2340
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023549 Nonsense 40 287 3 10
Genomic Location (Zv9):
Chromosome 6 (position 29422830)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 29718473
GRCz11 6 29709034
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTGTGTAATCATTGACAAACCTGTTCTTATGTGTAGTGGAGGGTGGCCAA[C/T]GAGCAATTATCTTTAACAGAATTGGAGGGGTCCAGTTAGAWACCGTCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40710
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023549 Essential Splice Site 281 287 9 10
Genomic Location (Zv9):
Chromosome 6 (position 29427483)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 29723126
GRCz11 6 29713687
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAGTGCTGATAGTTTGGTTATGAATCTACAGGATGACTCTTTTAACAAG[T/A]AAGAACTGTAAAGTCCTTACACAACTTCCTATATGACAGGCAGTTAAGAT
Associated Phenotype:
Not determined