Busch Lab

ZMP

mmp2

Ensembl ID:
ENSDARG00000017676
ZFIN ID:
ZDB-GENE-030131-9123
Description:
72 kDa type IV collagenase [Source:RefSeq peptide;Acc:NP_932333]
Human Orthologue:
MMP2
Human Description:
matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase) [Source:HGNC S
Mouse Orthologue:
Mmp2
Mouse Description:
matrix metallopeptidase 2 Gene [Source:MGI Symbol;Acc:MGI:97009]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa45285 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa34122 Nonsense Available for shipment Available now
sa1218 Nonsense Available for shipment Available now
sa21006 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa45285
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026712 Essential Splice Site 394 657 7 13
Genomic Location (Zv9):
Chromosome 7 (position 36877367)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 35151210
GRCz11 7 35422687
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCAAAAGCTTTGACGATGACCGCAAATGGGGCTTTTGTCCTGATCAAGG[T/C]GATGCAAAAATATTTTTTGATTCTTGTGTGTGATAGTTTGTATAATTTCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26992
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026712 Nonsense 395 657 8 13
Genomic Location (Zv9):
Chromosome 7 (position 36877158)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 35151001
GRCz11 7 35422478
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTAGCTTAAATCATTTTAAAAAATCAGCATCTGTTTTATTTTCAGGTTA[C/A]AGTCTATTCCTTGTGGCGGCCCATGAGTTCGGCCATGCCCTGGGTTTAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34122
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026712 Nonsense 481 657 9 13
Genomic Location (Zv9):
Chromosome 7 (position 36876403)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 35150246
GRCz11 7 35421723
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGTATGTAATGAAAACATCATATTTGATGCTGTAGCCCAGATCAGAGGA[G/T]AGATCTTCTTCTTTAAGGACAGGTAATACATTTCATTCATTCTTTTTTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2404
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026712 Essential Splice Site 587 657 12 13
Genomic Location (Zv9):
Chromosome 7 (position 36869134)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 35142977
GRCz11 7 35414454
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAAAGTAGAAATGTGTTGATCCTGATGTGTAAATGCTCACTTCTTTCCTC[A/T]GATACAATGAAGCCAAGAAAAAGATGGATCCAGGCTTCCCTAAAATTATY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1218
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026712 Nonsense 630 657 13 13
Genomic Location (Zv9):
Chromosome 7 (position 36865663)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 35139506
GRCz11 7 35410983
KASP Assay ID:
554-1127.1 (used for ordering genotyping assays)
KASP Sequence:
TATGTGGTATTAACACGTATGAACTGTTTTTAGGTCACAGCTACTTCTTC[A/T]AAGACTCACACTATCTCAAAATGGATGACAGCACTCTGAAAATTATCAAA
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa21006
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026712 Nonsense 654 657 13 13
Genomic Location (Zv9):
Chromosome 7 (position 36865589)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 35139432
GRCz11 7 35410909
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATGACAGCACTCTGAAAATTATCAAAGTCGGCGAGGTCAAAAAGGACTG[G/A]CTGCGCTGCTGAACATCGACAGACCATTCAGCTCTATGCCCTTCAACACT
Associated Phenotype:
Not determined