Busch Lab

ZMP

fat1

Ensembl ID:
ENSDARG00000017591
ZFIN ID:
ZDB-GENE-050425-1
Description:
protocadherin Fat 1 [Source:RefSeq peptide;Acc:NP_998132]
Human Orthologue:
FAT1
Human Description:
FAT tumor suppressor homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:3595]
Mouse Orthologue:
Fat1
Mouse Description:
FAT tumor suppressor homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:109168]

Alleles

There are 18 alleles of this gene:

Allele Name Consequence Status Availability
sa44505 Nonsense Mutation detected in F1 DNA Not yet available
sa38253 Nonsense Mutation detected in F1 DNA Not yet available
sa14711 Nonsense Available for shipment Available now
sa39579 Nonsense Mutation detected in F1 DNA Not yet available
sa12774 Essential Splice Site Available for shipment Available now
sa24837 Nonsense Mutation detected in F1 DNA Not yet available
sa1140 Nonsense Available for shipment Available now
sa39580 Nonsense Mutation detected in F1 DNA Not yet available
sa494 Nonsense Available for shipment Available now
sa32637 Nonsense Available for shipment Available now
sa13483 Nonsense Available for shipment Available now
sa25555 Nonsense Mutation detected in F1 DNA Not yet available
sa1599 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa44505
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010526 Nonsense 8 4610 2 29
ENSDART00000103262 Nonsense 8 4608 2 32
ENSDART00000145068 Nonsense 8 4611 2 27

The following transcripts of ENSDARG00000017591 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 16121209)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 16686377
GRCz11 1 17379314
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGTTTCAGAGAGGAGTGCGCTGCAAACATGCAGAACCACATGACTTCAT[T/A]GCTGGTGGTTCTGCTGCTCCTGTGCGGCTGCACTGCGAACCAAAGCCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38253
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010526 Nonsense 184 4610 2 29
ENSDART00000103262 Nonsense 184 4608 2 32
ENSDART00000145068 Nonsense 184 4611 2 27

The following transcripts of ENSDARG00000017591 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 16121738)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 16686906
GRCz11 1 17379843
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGGTGATGGCGACAGATGCCGATATTGGTACAAATGGAGAGTACTACTA[C/A]AGCTTCAGAGAATGGACAGACATGTTTTCTGTCCATCCCACAAGTGGCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14711
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010526 Nonsense 788 4610 2 29
ENSDART00000103262 Nonsense 788 4608 2 32
ENSDART00000145068 Nonsense 788 4611 2 27

The following transcripts of ENSDARG00000017591 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 16123549)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 16688717
GRCz11 1 17381654
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTCAAAGTGTTTGCTCCTCYTGATCGAGAAACAACTGATCACTATACAT[T/A]GAACATTACCGTGTATGACCTTGGAATACCCCAAAAGTCATCTTCACGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39579
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010526 Nonsense 821 4610 2 29
ENSDART00000103262 Nonsense 821 4608 2 32
ENSDART00000145068 Nonsense 821 4611 2 27

The following transcripts of ENSDARG00000017591 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 16123648)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 16688816
GRCz11 1 17381753
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTTCTTGATGTGAAGATACTGGATGCTAATGACAACAGTCCACAGTTTT[T/G]AAAGGAAACGTACTCTGTGGAAATCAGTGAGAGCTCCACTGTTGGAACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12774
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010526 Essential Splice Site 1212 4610 4 29
ENSDART00000103262 Essential Splice Site 1212 4608 4 32
ENSDART00000145068 Essential Splice Site 1212 4611 4 27

The following transcripts of ENSDARG00000017591 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 16177329)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 16742497
GRCz11 1 17435434
KASP Assay ID:
2259-0369.1 (used for ordering genotyping assays)
KASP Sequence:
TAYGTCTCGGAAGCTGGACAGAGAACAACAGGATGAGCACATTCTGGAGG[T/G]AAAAACACCTGGATTCCMYTTACAGTACTCNTGTTTTACAGCAGTCACTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24837
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010526 Nonsense 1500 4610 8 29
ENSDART00000103262 Nonsense 1500 4608 8 32
ENSDART00000145068 Nonsense 1500 4611 8 27

The following transcripts of ENSDARG00000017591 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 16221821)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 16786989
GRCz11 1 17479926
KASP Assay ID:
554-7291.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAAGAACAAGCTAACATACACCCTCCTCAGCAGCACTGACCCATTCAGTT[T/A]ACGGAAGTTCAGGCTTGATCCCGGAACTGGGGTGTTGTACACAGCAGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1140
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010526 Nonsense 1568 4610 9 29
ENSDART00000103262 Nonsense 1568 4608 9 32
ENSDART00000145068 Nonsense 1568 4611 9 27

The following transcripts of ENSDARG00000017591 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 16222294)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 16787462
GRCz11 1 17480399
KASP Assay ID:
554-1051.1 (used for ordering genotyping assays)
KASP Sequence:
AAGACACCAACGACAACGCACCTTGGTTCTCTGGTGCRCCGTATGTGGGC[C/T]GAGTGTTTGAGTCTGCTGCCACCGGCTCTGCAGTGCTTCAGGTCTCTGCT
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3359
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010526 Nonsense 1591 4610 9 29
ENSDART00000103262 Nonsense 1591 4608 9 32
ENSDART00000145068 Nonsense 1591 4611 9 27

The following transcripts of ENSDARG00000017591 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 16222363)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 16787531
GRCz11 1 17480468
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCACCGGCTCTGCAGTGCTTCAGGTCTCTGCTCTTGACAAGGACAAAGGC[C/T]AGAATGCTGAGATCATCTACAGCATTGAGTCAGGTAGTCCATCTGATTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39580
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010526 Nonsense 1906 4610 10 29
ENSDART00000103262 Nonsense 1906 4608 10 32
ENSDART00000145068 Nonsense 1906 4611 10 27

The following transcripts of ENSDARG00000017591 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 16223999)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 16789167
GRCz11 1 17482104
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACTTACAAAGGAGTTGAAGTGATCACAGTCAATGCCTCAGATGCAGACT[C/A]GGGTCCAAATTCAAGGCTTTTTTACTCTATTGTTGAAGGCAATATTGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa494
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010526 Nonsense 1994 4610 10 29
ENSDART00000103262 Nonsense 1994 4608 10 32
ENSDART00000145068 Nonsense 1994 4611 10 27

The following transcripts of ENSDARG00000017591 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 16224262)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 16789430
GRCz11 1 17482367
KASP Assay ID:
554-0211.1 (used for ordering genotyping assays)
KASP Sequence:
TCACCCAAGAATCATACAAGGCATTCGTGCCAGAAAATTCCTCAGAGAAG[A/T]AGACTTTAGCTGTAATTGCGGCAGTGGGAAACCAAGTCAATGAACCTTTG
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa32637
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010526 Nonsense 2434 4610 10 29
ENSDART00000103262 Nonsense 2433 4608 13 32
ENSDART00000145068 Nonsense 2434 4611 10 27

The following transcripts of ENSDARG00000017591 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 16225582)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 16790750
GRCz11 1 17483687
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTCTGATAGTGGAAAACTTGAATTTTCAATTTTGTCTGGAAATGAAGGA[C/T]AAAACTTTGCAATGGATCCAAACACTGGGGCTTTAGTCATATCAAATCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13483
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010526 Nonsense 2511 4610 10 29
ENSDART00000103262 Nonsense 2510 4608 13 32
ENSDART00000145068 Nonsense 2511 4611 10 27

The following transcripts of ENSDARG00000017591 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 16225813)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 16790981
GRCz11 1 17483918
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATTATGTGGTCGAGCTTCTTGAAAACTCACCTGTTGGAACACTGGTGGCT[G/T]AAGCCCAARCGACAGATGATGACTCAGGAACATATGGAAGACTTACCTAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25554
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010526 Nonsense 2665 4610 10 29
ENSDART00000103262 Nonsense 2664 4608 13 32
ENSDART00000145068 Nonsense 2665 4611 10 27

The following transcripts of ENSDARG00000017591 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 16226275)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 16791443
GRCz11 1 17484380
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTTCAGTGGTGTCATTGTAACAAAGGAAAGCCTCATTGGATTGGAGAAC[C/T]AAATGTACACATTTCTTGTACGAGCAAAAGATGGTGGAAATCCCACAAAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa39581
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010526 Nonsense 2846 4610 10 29
ENSDART00000103262 Nonsense 2845 4608 13 32
ENSDART00000145068 Nonsense 2846 4611 10 27

The following transcripts of ENSDARG00000017591 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 16226819)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 16791987
GRCz11 1 17484924
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAGGCCACAGATCTGGACTCGGGCACTAATGGTCATGTGGTTTACAATT[T/A]AGATCCCAACCAAGAGACAAGGGACATTGTAGAGTTGTTTGCCATAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25555
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010526 Nonsense 3294 4610 15 29
ENSDART00000103262 Nonsense 3293 4608 18 32
ENSDART00000145068 Nonsense 3294 4611 15 27

The following transcripts of ENSDARG00000017591 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 16239227)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 16804395
GRCz11 1 17497332
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTGCCCTGTCTTTCCTAGGTGGTGTGTTTGTGATCGAGCCATTGGATTA[C/A]GAAACGGCACATGAATTTTATCTGACAGTGGAGGCAACAGATGGAGGCAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2011
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010526 Nonsense 3388 4610 16 29
ENSDART00000103262 Nonsense 3387 4608 19 32
ENSDART00000145068 Nonsense 3388 4611 16 27

The following transcripts of ENSDARG00000017591 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 16240108)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 16805276
GRCz11 1 17498213
KASP Assay ID:
554-3404.1 (used for ordering genotyping assays)
KASP Sequence:
TCTCCATCATTGATGGGAATCAAGGCAGTCCATTCACTATCGACCCCGTC[A/T]GAGGAGAGGTCAAGGTGGCCCGGCTGCTCGACAGAGAGAAGGTATAAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1599
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010526 Nonsense 4165 4610 27 29
ENSDART00000103262 Nonsense 4163 4608 30 32
ENSDART00000145068 Nonsense 4166 4611 25 27

The following transcripts of ENSDARG00000017591 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 16255178)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 16820346
GRCz11 1 17513283
KASP Assay ID:
554-1540.1 (used for ordering genotyping assays)
KASP Sequence:
TACGGCTCCTTTAGCTGTAATTGCTCCAATGGTTACAGCGGCCAACATTG[T/A]GAACTTCGTTCCGAAATCCGCAACGAATTTGTCTCCACCTCCTGGAACAT
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7901
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010526 Nonsense 4347 4610 28 29
ENSDART00000103262 Nonsense 4345 4608 31 32
ENSDART00000145068 Nonsense 4348 4611 26 27

The following transcripts of ENSDARG00000017591 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 16256980)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 16822148
GRCz11 1 17515085
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGTTGGTAATTAAAAGNTTTTTTTTGTCCTCACAGCTAAAGTGRTGGACT[T/A]GGACTCATGTTTAAGTAAAAAGCCGGTGGAGGACAGTGCATGTCACCCGT
Associated Phenotype:
Not determined