Busch Lab

ZMP

ctdp1

Ensembl ID:
ENSDARG00000017522
ZFIN ID:
ZDB-GENE-040720-1
Description:
RNA polymerase II subunit A C-terminal domain phosphatase [Source:RefSeq peptide;Acc:NP_001002873]
Human Orthologue:
CTDP1
Human Description:
CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1 [Source:HGNC
Mouse Orthologue:
Ctdp1
Mouse Description:
CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1 Gene [Source:

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa36797 Nonsense Mutation detected in F1 DNA Not yet available
sa43245 Nonsense Mutation detected in F1 DNA Not yet available
sa23474 Nonsense Available for shipment Available now
sa23473 Nonsense Available for shipment Available now
sa32238 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa36797
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111517 Nonsense 203 951 5 14
Genomic Location (Zv9):
Chromosome 19 (position 12455574)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 11913920
GRCz11 19 11832262
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGATCTTGTTTATATTTTTCTTCAGGGAATCTTTCATTTCCAGCTAGGA[C/T]GAGGGGAACCTATGCTTCACACACGACTTAGACCTCACTGCAAAGACTTT
Long Flanking Sequence:
AATAGTTTTGTTACTATTTTTACAGTCTTCAAAATCATAAATAAAGCCTTGCTGAGTATAAGATACTTTTTTTTAATCAATAAATGGTAATCTTACAAAGTCCAAACTGTCACATTATCAAAAATAAAAAACAATGGTCCTTTAGTTAATGTTTTTATTAACATCCACAATTAGTGATACATTTATTACAGGATTTATTCATCTTTGTTAACGTTAATGTAATTTAAGCTAAAAAAACATGTTTATTCCCTTTGCATTAACCATGATTGAATTTTGATAATGCATTAGTAAATGTTGAACTCAATTAATTAATGCAAGATTATTTATACTAAATGTTAATATATTAAGTAATATTAACTAACGGACTATTATTCTAAAGTGTCTAAACTTGTCTAATATTGTTATGCTAGTTTATATATTGTGTCGTTTTCTAGTTAAGTTGATCTTTTCATGATCTTGTTTATATTTTTCTTCAGGGAATCTTTCATTTCCAGCTAGGA[C/T]GAGGGGAACCTATGCTTCACACACGACTTAGACCTCACTGCAAAGACTTTCTTGAAAAGATCGCCAAACTCTTTGAGCTGCACGTCTTCACCTTCGGCAGCCGTTTGTACGCTCACACTATTGCAGGTACATTACTGTCATGTGGCAGACTTTTTTTTTTTTAAATGAAAAATTTGTAAAAAGATTTCTTCTATTCCCTTTATGCTGTGAAACATGAATGATACTTCAGACCTTGAGGAAAGTTACAAATGTATTTTTTTTCTGAGCGTTTCCCCCCCCTTTGCCTAGTGAATGAGAGATCATGTTGTTCTTTTATTATAACACCAGGTGGCAGTATTTGTTCATATTCTTAGCATTTGATGGGTGCAAAGTTTGCTGTGTTTGCATATTTATTACAACAAATTGTAGGATTATGGATATAGAATATGATCATGCTGAATATGTACTTTATAAGTACTACTAAACAGCCAATATGTAAATAGTAGGCTTGCTATAGGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43245
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111517 Nonsense 348 951 8 14
Genomic Location (Zv9):
Chromosome 19 (position 12439061)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 11897407
GRCz11 19 11815749
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTAATCAGGGCGGACGGACTGTGGAAGGCACAGAGTCAGGACAAGAGGAA[C/T]AGAGAAATGGCCTTAGAAAATCCAGCAAGGATCATAAAACTGGGCATGAG
Long Flanking Sequence:
GTTAATGCTTTTGAAGTGGCAGACGCCATCATCCCACTCATCTGCACTTTTATATGTTTGATTTTTTTTTTTTTAGCTTGGTTTTGCAATTCTGATTGGGCAGAACGAAAGTGTGCTCACTCAAATGGCTAGTAAGACTGTCACACATAGACGCCATGCACGTGTTTGCTCTGGGTGGGGGAAATGAAATAATACATATTTCATACCGCAGCCTCTTGCAATTAGCTAATCTCAACTTTTGAAATCACGATTGCATTTCGATTTCGGTTAATTGCACAGTCCTATCGCCCTGTATCCAAAATCAGTTTAAAAAACAACACTATAATGCTTTAATAATTTAAAGTAATAATGTGTAGAGTAGAATTGCATTCGAATTTGTAAGACTCTTTATAAACACAAGCTGTTTCTCAAAAGTTGTGTCTAAGAATTCCTTCCGTTGTCATGCTGTAGGTAATCAGGGCGGACGGACTGTGGAAGGCACAGAGTCAGGACAAGAGGAA[C/T]AGAGAAATGGCCTTAGAAAATCCAGCAAGGATCATAAAACTGGGCATGAGGAATCGTCCACTTCTTCCACTGCCACTCAGGGAGCTTCAGCCAATGAAAGGACTCACCCCACTGGGGAACAGCCTAATGAGAGCGCAGATTCAGGGGACAAATGTACTGTGAAAACAGAGGCAGAGGGCAGCTCAGGTGTGTCATGTATCTCAGGTGAAAGTGAAATCCCAAATGCTGCTCCTGATGCTGCTGCTGCCAACGACCTGGATTTTGACCTTTCTAGCGACAGCGAAAGCGAGGGTAAAATGGAATTATCTGACAGCGATGGTGAGGGAAAGACAGCAGACACTGGGAAACCCAAACAAAGAAAAAATGAGGAGTGTAAAAGCAAAGAGGATGATGGAGACAAACAGAGGACAGAGGGGGGTGATGGTCCAGTAACAGATCCTGAGGGTCTCCGTGATTTGGGCAACGGCTGTTCCGACAAAAAGGAAATGGAAACTGAGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23474
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111517 Nonsense 621 951 8 14
Genomic Location (Zv9):
Chromosome 19 (position 12438242)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 11896588
GRCz11 19 11814930
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTATCCCACCAACTACCCAATGGAGCGCACCAGAGAGTGGTATCATGGC[A/T]AGGCACTGGGTGCCAAACTTTGCAAGACCTTGGTGCTCAATGCCAAAGAC
Long Flanking Sequence:
GTGAGGGAAAGACAGCAGACACTGGGAAACCCAAACAAAGAAAAAATGAGGAGTGTAAAAGCAAAGAGGATGATGGAGACAAACAGAGGACAGAGGGGGGTGATGGTCCAGTAACAGATCCTGAGGGTCTCCGTGATTTGGGCAACGGCTGTTCCGACAAAAAGGAAATGGAAACTGAGTCTCAAAACAGCGAACAGTCAGGTGTGACTATGGGGGAAGAGTCTTTAGATCACAGTATGGAGGATGAGGATGATGAGGAAGAGGAAGACGTAGACCAGGACGACCACCTCATTTACTTGGAGGAGATTTTAGTTCGCATTCACAATGAGTATTACTCACGCTACGAGGCCTTCCTTAAGAAAGAGAGTTCAGAAAGTCCGGATATACGCAAAATTGTTCCAGAACTAAAGGGCCGTACACTAGCGGGAACCACAGTCATTTTCAGTGGCCTGTATCCCACCAACTACCCAATGGAGCGCACCAGAGAGTGGTATCATGGC[A/T]AGGCACTGGGTGCCAAACTTTGCAAGACCTTGGTGCTCAATGCCAAAGACCCCAACCGGACCACCCACCTCATTGCTGCTCGTGCAGGTGAGTCATGCGTATGCCTAAAACGTACCACTTAAGAATGGGTGTTGTCAAAACAGACTAGTCTTTGGGTTGTTTAAGTGAACTTACTTCTGTAATTGTAATTTTGGCCACTACAGGCAATTTTGTGTTTCATTTTTTAGAGTGTATAATTTACAGCGTATTGTTTATTACACAACGTTTTTCACAGGCAGATAATTTGTTTAATATTATTCAAAGAATACTAATGAGACTCATTACTTTTTGTTATACATGTATAGAGTGAAGATGGACATATGACGTAGATGTGTACTTGATGTCTTACGTTTTAACATTTTAAATTCTAAATGATTAAATGCCATGCTTTACTGTATATCATCGTAATATTGGATTTTTCAATCGTTTTAGTTTTTATTAGGTTTTCAATTTTGAAATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23473
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111517 Nonsense 692 951 9 14
Genomic Location (Zv9):
Chromosome 19 (position 12415965)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 11874311
GRCz11 19 11792653
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGCGCTGGGAGCGAGTAGAGGAGCAACTCTTTCCTCTCAAAGAGGACTA[T/A]AACAAATCACACAGGTATTTATCTTTTACAGCCTTCTACTTCTTTTTCCA
Long Flanking Sequence:
TAGGCCACCTCTGCCATTTCATTGACTTACTTTTATTCATGCCTCTGAGACAAAGACGCACTATTTTTTTTATGCGCATATTCAAAATGCACATAAAAATAGGTGGATGAAAACATAGCTACTGTAGCCTGTGCAATTTAGCATTAAAACTTTATTTATATGATAAACTTTGATTGAAAAAAGAAATAGAAAAATGTTTTTTGACTTTTTTAGTAGGTTTTTTTATTGCAACACATTCAATTCAGATTGCAATTTTCTTTTGCTGTGCTGCTGCCTTCTGCTCTGCTGATAGTGGAGAGAAAAACACCGACCGATCATATTTCACATTGCAGTGTGGTTTATCTAAATAGTGTTTTGTTTGTGTCTCTGTCAGGTACAGAGAAAGTTCGTCAAGCTCTGGGTTGTAAACATCTCCATGTGGTAAATCCTGATTGGTTGTGGGCTTGTTTGGAGCGCTGGGAGCGAGTAGAGGAGCAACTCTTTCCTCTCAAAGAGGACTA[T/A]AACAAATCACACAGGTATTTATCTTTTACAGCCTTCTACTTCTTTTTCCATCCTTTATGTTCACTTGTGGCTTTCAGTATGAAGTAGGTATTGTCAGTATTTTCTGTTGTGACTGCTGAAATTTTCATTGTGTTGTTCACTCATCACTACAACGCTCATGAATAGAACATGAAGCATTCAACAACTTATTATTTTTCAGCTTGCACTGACACTTGCAATATTAAAGTAATATTAAATAAATCAGTTTCCCTAAAACTTCCTCATGGCACAGTAAGGGAGATGCTTAGCAGAACGTTGATGTAAAGTGAGCGCTGGCCATGAGTCAAGCAAGATTTTTTCCATCTGCTTGTTTACACATAGATTTCATATTTCTTCAATCGGAACTGAACTATGTGTGTGCAATATGACGATTTTTGATGGAGGATGATTAAAATGTCTCCATGATCTGCTTTGCGAGGTATATCATAATATCGTGCTTCTCATTATACACTATAAAAAAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7878
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111517 Nonsense 801 951 11 14
Genomic Location (Zv9):
Chromosome 19 (position 12402582)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 11860928
GRCz11 19 11779270
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGCAGGATCGAGTCCAGACGATGAGCAGCCCGGACCTTCGCGCAGAAAA[C/T]GACAGCCCAGCATGTCGGAAACCATGCCGCTCTACACACTCTGTAAAGAA
Long Flanking Sequence:
AAAATAGTTTTAGTTGAACAAAATGAAGAAATGCACATTTTGCAGACTCCTTGACCAAAAATACTCCTTTAATCATGGGTTTAAACAGACCGCAAGAGCACATGCAGTGAGGTTAATCGATTCTTCACTCGCCATCCATTTCCTCGAGCCGAATGATCATAATTATCGTTCCGTGGCTCCTCTGACAGAACTGCAGACGTGATTAAATGTTTGTTGTGTGCTTGCGGACAGGCGTGTGCTGTTTGTCTGTGTTTGATTGCTTATTTAGATGTTCCTCAGTCCGAGCGAGACGCTGTTCGAAGCAAACTCGGCCAGTTTTGCTTGATTGCCGAGTGACTGATTGCGTCGTAAGTTGCTTGACCGGCTGCTGCTCTAGAGTTTGTGTGTTGAGCGATTGATTGTTGATGTGTTTGTTCAGGTCAGCTCAGGGGTCTCAGCAGACAGATGAGCCTGCAGGATCGAGTCCAGACGATGAGCAGCCCGGACCTTCGCGCAGAAAA[C/T]GACAGCCCAGCATGTCGGAAACCATGCCGCTCTACACACTCTGTAAAGAAGACCTGGACAGCATGGACAAAGAGGTTAAACGCACACATACACACACAGACTCTCAGACATAATAGTCATATATTCTATCCCTATACCCCAACCCTACCTCTAAACCCAACCCTCACAGGAGATAATCTGCACTTTTACATTTTCAAAAAATAACATTCTGTATGATTTGAGCATGTTTACCTGTAGGTATTTACATTAGATGTCACCTACGCTATTGTTGTCTATTGGAAGGAATGCATCAATAGAGCTGCCATTTTAGTACAGGGTAGCGCTTTGAAATGAATGTGGGACCAAGGTGTAGTGGAGCACTGGCCATCTGGAGCGATCATATCTATACATTAGGGATGTAACGGTATCAGAATTTCACGGTACGGTAATACCTCGGTATGAATGTCACGGTACGGTATTTATTGAATCATTTACAGGAAAAACAAAACTTTTGAAAATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32238
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111517 Essential Splice Site 825 951 11 14
Genomic Location (Zv9):
Chromosome 19 (position 12402507)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 11860853
GRCz11 19 11779195
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCCGCTCTACACACTCTGTAAAGAAGACCTGGACAGCATGGACAAAGAG[G/A]TTAAACGCACACATACACACACAGACTCTCAGACATAATAGTCATATATT
Long Flanking Sequence:
TGGGTTTAAACAGACCGCAAGAGCACATGCAGTGAGGTTAATCGATTCTTCACTCGCCATCCATTTCCTCGAGCCGAATGATCATAATTATCGTTCCGTGGCTCCTCTGACAGAACTGCAGACGTGATTAAATGTTTGTTGTGTGCTTGCGGACAGGCGTGTGCTGTTTGTCTGTGTTTGATTGCTTATTTAGATGTTCCTCAGTCCGAGCGAGACGCTGTTCGAAGCAAACTCGGCCAGTTTTGCTTGATTGCCGAGTGACTGATTGCGTCGTAAGTTGCTTGACCGGCTGCTGCTCTAGAGTTTGTGTGTTGAGCGATTGATTGTTGATGTGTTTGTTCAGGTCAGCTCAGGGGTCTCAGCAGACAGATGAGCCTGCAGGATCGAGTCCAGACGATGAGCAGCCCGGACCTTCGCGCAGAAAACGACAGCCCAGCATGTCGGAAACCATGCCGCTCTACACACTCTGTAAAGAAGACCTGGACAGCATGGACAAAGAG[G/A]TTAAACGCACACATACACACACAGACTCTCAGACATAATAGTCATATATTCTATCCCTATACCCCAACCCTACCTCTAAACCCAACCCTCACAGGAGATAATCTGCACTTTTACATTTTCAAAAAATAACATTCTGTATGATTTGAGCATGTTTACCTGTAGGTATTTACATTAGATGTCACCTACGCTATTGTTGTCTATTGGAAGGAATGCATCAATAGAGCTGCCATTTTAGTACAGGGTAGCGCTTTGAAATGAATGTGGGACCAAGGTGTAGTGGAGCACTGGCCATCTGGAGCGATCATATCTATACATTAGGGATGTAACGGTATCAGAATTTCACGGTACGGTAATACCTCGGTATGAATGTCACGGTACGGTATTTATTGAATCATTTACAGGAAAAACAAAACTTTTGAAAATACTCCAAAAAAGTGCCAAAAGTGTCAATGACATACAAATTAGTCATCTATCTGTAAGCTTTGAAACAGGAACTTCAA
Associated Phenotype:
Not determined