Busch Lab

ZMP

adcy3

Ensembl ID:
ENSDARG00000017437
ZFIN ID:
ZDB-GENE-041014-276
Description:
Novel protein similar to vertebrate adenylate cyclase 3 (ADCY3) [Source:UniProtKB/TrEMBL;Acc:Q5SP66]
Human Orthologue:
ADCY3
Human Description:
adenylate cyclase 3 [Source:HGNC Symbol;Acc:234]
Mouse Orthologue:
Adcy3
Mouse Description:
adenylate cyclase 3 Gene [Source:MGI Symbol;Acc:MGI:99675]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa1806 Missense F2 line generated Not yet available
sa39307 Nonsense Mutation detected in F1 DNA Not yet available
sa10668 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1806
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016530 Missense 207 1100 2 23
ENSDART00000148071 Missense 208 1053 2 20
Genomic Location (Zv9):
Chromosome 20 (position 46915125)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 46760408
GRCz11 20 46664128
KASP Assay ID:
554-1798.1 (used for ordering genotyping assays)
KASP Sequence:
GTTTCTTGCAGCTCGTGGCGAATCTGATGYTGTATTTTGGTGCCATGCTG[G/T]TGGGTGTGATGTCATATTTCATGGCTGACCGTAAATACCGCACAGCGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39307
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016530 Nonsense 776 1100 16 23
ENSDART00000148071 None None 1053 None 20
Genomic Location (Zv9):
Chromosome 20 (position 46936696)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 46781979
GRCz11 20 46685699
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGGACTACAGGTGAGACCAGCTCCAGTCTGAAATACATTGTGGATACTG[T/A]AAATTGATTGCATTTCAAGCGATGTCTGCCAAATGCATGAATATGTAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10668
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016530 Nonsense 861 1100 18 23
ENSDART00000148071 Nonsense 814 1053 15 20
Genomic Location (Zv9):
Chromosome 20 (position 46938561)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 46783844
GRCz11 20 46687564
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGACATACAACGAGGCGCTGGTCACAAATATGCTTCCCGAACACGTGGCC[A/T]AACACTTCYTGGGCTCCAAGAAGCGAGATGAGGTGTGCATNAAAACTTGT
Associated Phenotype:
Not determined