Busch Lab

ZMP

smarcc1a

Ensembl ID:
ENSDARG00000017397
ZFIN ID:
ZDB-GENE-080514-3
Description:
Smarcc1 protein [Source:UniProtKB/TrEMBL;Acc:Q7ZUU5]
Human Orthologue:
SMARCC1
Human Description:
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1 [S
Mouse Orthologue:
Smarcc1
Mouse Description:
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1 Ge

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa16518 Nonsense Available for shipment Available now
sa22926 Essential Splice Site Available for shipment Available now
sa36232 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa16518
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109259 Nonsense 482 1089 16 28
Genomic Location (Zv9):
Chromosome 16 (position 45216859)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 42541942
GRCz11 16 42445700
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTTCATGTTTGTTTTGCTGTCTAAATTGCYTTTTCTCTTATTTGTAGTTA[T/A]CTTGCCTATCGTAACTTCATGATTGACAMTTACCGGCTGAATCCTCAGGA
Long Flanking Sequence:
TGGTAAATTACAGTTGGCATTTGAGAAAATGCCATTAAATTTTTTTCTTGGAATTCTATACAACAGAATACTGTAACAAATGGCATCTGATATAATGTGACAAAGTATGTATATTTATATAAATATATAATTTGTACATCTTGGAAAGTGCTTAAAGTGTTTAAATTTAACTCTGGAAAATGTGTAAGAATTCTGAAACTCCCACATGCATTATCTATTAGTTTTATGCATTGTGCAATTGAATTGAGTCATAAAGTTTAATGCATATTAAATGTCCTTTTTTCCAGTATACATGAAATTGAGAGACGTGCCCTGCCAGAGTTCTTCAATGGCAAAAACAAATCGAAGACTCCGGAGATGTACGTTCAACCTTGTACTTCTGTCATGTAGACTAGACTTTTATATAAGATCAACATGCATCATCCTGTTGTGTTTCTTTGTGGTTCTTTAGTTCATGTTTGTTTTGCTGTCTAAATTGCCTTTTCTCTTATTTGTAGTTA[T/A]CTTGCCTATCGTAACTTCATGATTGACACTTACCGGCTGAATCCTCAGGAGTACCTGACCTCAACCTCCTGCAGGAGGAACCTCACTGGAGATGTCTGTGCGGTCATGAGGTCAGAATTCTCATTTAAATATCTGACTTCATTATAATAATATACAGAGAGTGGGTTCAGTTGGACTTTCAATTTTAGTTGGTGTGGCTATTTCAAGTATGAAAAGACATCAGTAATTTAATGTTGCATTTCCGTCAAGCCATTTAAAGTCCATAGCAAATCAAAAGTTGCTGATGTGGCAATGTGCAAACCATATTTAGCTCAGTGTTGGATATATTAAATAACAAAATCTAAAAATCTGTTTTAATGTTATTTTTTTTACCCTCTCATTGAATTATTAAGTTGTCTATATTAGCACATTCATTGTTGCATATATGTATATCTACATTTGTTTAATAGTTTTAGATTTTTCATTAGTTTTAGCTTTTTTTTTCAAATTAATTTAGCTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7807
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109259 Essential Splice Site 570 1089 17 28
Genomic Location (Zv9):
Chromosome 16 (position 45214978)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 42540061
GRCz11 16 42443819
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGCTGATACTCCCTCTGGCCTGGTGCCGCTGCACCACCGTCCCCCACAGG[T/C]GAGACTGGGGTCACTTCCTTTTWAATTCCCAGAAGGCACRAGGCTTTCTT
Long Flanking Sequence:
ATTCATAGTTACTTGACTCATTAGTATTTAATGTATAATTGAACAAATTTGTCATAAAAAATAATTGTACTTTTGAACAAACTGGAATTTAGTGTGAATATAAAAAGGTAAACTTTGAATTAAATGTTTGTTTACAAGTTTATTTAAACTTGGAATTTGAACAAATAATTGAAATTTACCAAAAATGGTAATGTTTGACAAACTTTTAAAACTGTGCCTGATCTATACCTTAATGAAATAGAGATGAGATAGGATTTTATCTGAATCTTGAGCTTAAAAATCAAATTGTAAATTGTCAATACGGAGCCCTATTGTGCATTTTCATTGTGTTTTTTTTCCTCCCAGAGTGCATGCCTTCTTGGAGCAGTGGGGACTGGTGAACTACCAGGTGGACGCGGAGAGCAGACCTCTCCCTATGGGCCCTCCACCAACCTCACATTTCAATGTTCTGGCTGATACTCCCTCTGGCCTGGTGCCGCTGCACCACCGTCCCCCACAGG[T/C]GAGACTGGGGTCACTTCCTTTTTAATTCCCAGAAGGCACGAGGCTTTCTTTTGAATCTGCTACAACAAATTCTCTGCTGTTCCTGCCAGGTTCCCCCTGCTCAGCAGATGCTGAACTTCCCAGAAAAGGGCAAAGACAAGCCAACCGACCTGCAGAACTTTGGCCTCCGTACAGATATTTACTCCAAGAAGAATCTCAAGGCAAGTCGCAATCCCTGTGCCTTCTGCCAAACCCAATACTGCTCGCTCTTCTGTCTTTTATAGTTCCTTGATGTGATTATGTGGAACATTTGTTTCAGGACTCTCTGCTGTTTCTTCCTTTAGTTCGGTTTGTTTAGGCATATAGATGTAGTTTTAATGTTCTATTGCACAGCAGTTGGTTCGAGATGAAAAATTGTTAGATTCAATTAACTAAATTGTAATTCCTGAACCGAAACAAATGTTGCGCAACAAGCAGCAGTGTCTAATACCGCTTTTCCAACAGCATGAACCGGGTGCTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22926
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109259 Essential Splice Site 886 1089 24 28
Genomic Location (Zv9):
Chromosome 16 (position 45202243)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 42527326
GRCz11 16 42431084
KASP Assay ID:
2261-0202.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGCCACCGCTGCAGCCGCCGCTCTGGCCTCTGCCGCCACCAAGGCAAAGG[T/A]AAAGCATTCAGACTGCAATGTTTAGCAGTTCTTGAACTTCCTCTGGTGAC
Long Flanking Sequence:
GCTAATATTAGCATTTTCCAAGATCTCCTATTGCTGCTTTAACTAGAGTTGTGCTTTGGATTGACAGAAATGCATCTTAAAACTAGCAAACTCTGATATTTTTGAAGGACAAGGCTATGAGTTGTATCAGAGTTTGAGGACCCAAGTGTATTTATTCACAGCATTTAGTCCCGTTCTCTTTTTAGTCCTTCAGGTGGTTATATATTGAAACGATAGTGTATTGGAAAGATGATTGTGTATTGGAAAAATGATAGTGTACTGGTAAAAAAAAATACATATTTTAAGTCCTTAAGTTTATTCTAAAATGTTTCTAACAAACCCATATGGTCATTTACTTTCAGAGAAAGAAAAAGAGGAGGCCATGGAGACCACAGAGGAAGGGAAGGAGGATGAGGAGGAGCAGGAGGAAGGAAAGAAAAAGCTGGAGTTGGATATTGGAGAGGGCAACATCGCCACCGCTGCAGCCGCCGCTCTGGCCTCTGCCGCCACCAAGGCAAAGG[T/A]AAAGCATTCAGACTGCAATGTTTAGCAGTTCTTGAACTTCCTCTGGTGACACCGACTGCTTTGTGCAGCTGTCTCCAGTTTTTAATCACTCTGGCGGCTAAGTTGATTTCATGTACTGTCTTTTCTTCTTTTCTTTCTCAGCACCTGGCTGCAGTGGAAGAGAGGAAGATCAAATCTCTTGTTGCTCTGCTAGTGGAGACTCAGATGAAGAAGCTGGAGCTCAAACTCAGACACTTTGAAGAGCTGGAGACCATTATGGACCGTGAAAAGGAAGCTGTGAGAATTTTTTTTTCTTTTACGTTTTTTATAGATAAATTCACCCCTCTTTCCAATTCTGCTTCAAAAAAACACTTGTGTCATAACTACACATTATGGTTGAATCACTATTAGTCTCTTTAATTCATTATTTGTACAGCTAGCATCTTTCAATAGTGTGCTTTCCAAAATAAGCAGAGCAAGAGAAAATATACATTTAAAGGCCTTTCTTTTAGTGATGATCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36232
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109259 Nonsense 974 1089 26 28
Genomic Location (Zv9):
Chromosome 16 (position 45199603)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 42524686
GRCz11 16 42428444
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGCCCGTCAGCAGATGGAGCAGCAGGCAGCGGTGCAGCAAAACGCTGGA[G/T]GACATCATGGTCCTCCTCCACATGGACCACCTCCAGGCATGCACCCTGGA
Long Flanking Sequence:
TTATTTTATTCTTTTTATCTAGTATATTCTGTTTTTTGTGTTGGAAACGCTGCATAAAGATGTTCTGTTGTTCTCTTGTTAATATGTTCGCATGTTAAAATAAATCAGTATTTTAAAAATGCCATATTTGATGTCTCACAAACTAGACACTGTAGATATAGCAGATGTTGACAACACTGTCCTAGCAAACAGATCAGATTGGAGTGATTGCAAGATAAGTTCAGCCATTCCAATCTAATGATTGAATTGAAAAACAAAATAAAATGTTGTGCTTGTGTGGATTGTGTGAATTTAAACTTCCCCTCGTGTGCTATTTAATTTATGCTTTGATTTATCAGTTGTATTTTTTTTATTTTTTTTGTCCCTCTCTTTAGCTGGAGCTCCAGAGGCAGCAGCTTTTGACCGAGCGACAGGCGTTCCACATGGAGCAGCTGAAGTATGCTGAGATGAAGGCCCGTCAGCAGATGGAGCAGCAGGCAGCGGTGCAGCAAAACGCTGGA[G/T]GACATCATGGTCCTCCTCCACATGGACCACCTCCAGGCATGCACCCTGGACATCCAGGACATCCTGGACACCCCGGCCCTGGATTTCCACCAATGCACCACCCCATGGGTCCACATCACACCCCTCAGACAGGTCAGCCGTCACTGTGAGCTTCGGGTTGATGTGTTTGAGGTTTATTGGGTTCTAGGGATGCTCAAAATAATCGATTAACCGTTAACCGAAAGGGTGCGTTTGTGACCGATTAATGCTATCAGTTAAACGATTAAAATTATTATTTTATATATTTTTAGTTTGGCTGCATTAGGGGCTGATTGAATACGCCTTTGCGTTAAGAGGGGCATTTCTTGCACGCGGCTCATCCCAGAGCAGCTTTTTGTGTTGTCTAAACAACTACAGAGAACTTTTAAAGAGCTTGGTTTCCGCTACATTCATTCTTCCATGGCGGGGCATCCCGCCACGGCTACATTACGCATTCAGAACATTTAGTTATTGTTGTTGTT
Associated Phenotype:
Not determined