Busch Lab

ZMP

si:ch73-6o20.1

Ensembl ID:
ENSDARG00000017391
ZFIN ID:
ZDB-GENE-100921-10
Human Orthologue:
UNC13B
Human Description:
unc-13 homolog B (C. elegans) [Source:HGNC Symbol;Acc:12566]
Mouse Orthologue:
Unc13b
Mouse Description:
unc-13 homolog B (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1342278]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa44602 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa9739 Nonsense Available for shipment Available now
sa14652 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa44602
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064752 None None 1192 None 31
ENSDART00000128664 Essential Splice Site 89 255 3 7
ENSDART00000131918 Essential Splice Site 73 267 2 8
ENSDART00000140710 None None 761 None 18

The following transcripts of ENSDARG00000017391 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 20893913)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 18606770
GRCz11 5 19110570
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGATAGGAACAGCATGGATCCCACTTAACACCATCCACCAATCAGATGAG[G/A]TAAGTGGGCACCACCAGCCAATCAGATTGTAGAGTCATGAATCTCAGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9739
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064752 Nonsense 107 1192 3 31
ENSDART00000128664 None None 255 None 7
ENSDART00000131918 None None 267 None 8
ENSDART00000140710 Nonsense 84 761 2 18

The following transcripts of ENSDARG00000017391 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 20950970)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 18663827
GRCz11 5 19167627
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGGGGTATTGCGMGGCAGGGCATGCGCTGCTCAGAGTGTGGAGTCAAATG[C/A]CAYGAAAAATGCCAAGAGCTTCTCAACGCAGACTGTTTGCARAGTGAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14652
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064752 Nonsense 577 1192 14 31
ENSDART00000128664 None None 255 None 7
ENSDART00000131918 None None 267 None 8
ENSDART00000140710 Nonsense 552 761 12 18

The following transcripts of ENSDARG00000017391 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 20976737)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 18689594
GRCz11 5 19193394
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAACTCAYCACCCTGATAGTGTCCATCATAGAGGAGGATAAGAATGCCTA[C/A]AACCCCGTTATCAATCAGTCAGTCACTGCAGACACACAATATTACACAAA
Associated Phenotype:
Not determined