Busch Lab

ZMP

kidins220b

Ensembl ID:
ENSDARG00000017338
ZFIN ID:
ZDB-GENE-030131-7824
Description:
Kinase D-interacting substrate of 220 kDa [Source:UniProtKB/Swiss-Prot;Acc:Q7T163]
Human Orthologue:
KIDINS220
Human Description:
kinase D-interacting substrate, 220kDa [Source:HGNC Symbol;Acc:29508]
Mouse Orthologue:
Kidins220
Mouse Description:
kinase D-interacting substrate 220 Gene [Source:MGI Symbol;Acc:MGI:1924730]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa43464 Nonsense Mutation detected in F1 DNA Not yet available
sa43465 Nonsense Mutation detected in F1 DNA Not yet available
sa43466 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4908
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019181 Nonsense 505 1672 14 28
ENSDART00000101603 Nonsense 513 1731 13 29
ENSDART00000146366 Nonsense 513 1680 14 28
Genomic Location (Zv9):
Chromosome 20 (position 29783856)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 29855069
GRCz11 20 29757948
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGGTCAGCAGGTGGAGCCTTTGTTCCAGTTTTCATGGCTGGTTGTGTTAT[T/A]ATCGCTCCTGCTGTGCGGCTCCGTTGCGCTAGTGCTCGGCTTCACCGTGG
Long Flanking Sequence:
ATTTTACTGCATTCTCTGTATAGGCTGTGAGTGACCTGTGTGTATTTTTGCCCCTCTGTGTGTTGTCCCCTTTAGGACATCTGTCCCCAACAGAGTCAGATGGGGACATGCTGGGCTACGACCTGTACAGCAGTGCTCTGGCAGACATCCTGAGTGAGCCCACCATGCAGCCGCCCATCTGTGTGGGTCTGTACGCCCAGTGGGGCAGCGGCAAGTCCTTCCTGCTCAAGAAACTCGAGGGTGAGCGTTATTTACAGGCGCTCGGCTTAAACTTGACCTAAAAAGGATATTTTAAAGCACAGTTTACTCATGCACAGCATGTACCTACCTAGCTTTTTAGCTATTTCTGAGCTTGAAATGTTTAATAGAACTCAATTCGCCGCATCTGGTGTATATTTATTGGTGGACGAATCTTCATATTTCTTTCTCAGATGAGATGAAGACATTTGCAGGTCAGCAGGTGGAGCCTTTGTTCCAGTTTTCATGGCTGGTTGTGTTAT[T/A]ATCGCTCCTGCTGTGCGGCTCCGTTGCGCTAGTGCTCGGCTTCACCGTGGACCCCAAGCTTGCTATCGCCATCTCTCTCAGCATCCTAGCACTGCTTTATGTGTTCTTTGGTAAGAAAAGCTAGCCTCTTATTACCTCTGTATGAAATGTATCACATAAATTAACGATGATATGATATTGAATCAGCAACCATTAAAAGGTATAGTGAATGTATACTATCTCTGCTCAGTGGTTGTGTACTTTGGGAGCAGACGTGAGGGTGAAAGCTGGAATTGGGCGTGGGTCATTAGCACCCGTCTTGCCCGACACATTGGATACTTGGAGCTTCTGCTCAAACTCATGTTCGTCAACCCTCCAGAGCTTCCAGAACAGACCACCCGAGCTCTGCCGGTCAGGTAATTACCCACACATAAAGCATTAGGCCATTAAGACGTCCGAAATATTGGATGTGGATTTGGGTGTCCTTGGACTCCACAAGACCACTGTTATTGCCTTTTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43464
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019181 Nonsense 976 1672 22 28
ENSDART00000101603 Nonsense 984 1731 21 29
ENSDART00000146366 Nonsense 984 1680 22 28
Genomic Location (Zv9):
Chromosome 20 (position 29793333)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 29864546
GRCz11 20 29767425
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACTGGGACCGGCTCGCATCTTGGATCAACCTGACTGAGCAGTGGCCGTA[T/A]CGCACCTCCTGGCTCATACTCTACCTAGAAGAGACCGATGGCATCCCAGA
Long Flanking Sequence:
TAACCTAGTTAAGCCTTTAAATGTCACTTTAAGCTGTATAGAAGTGTCTTTAAAAATATCATCAGAATTACTGTCATCATGGCATTGAAATGAGGTATTAAATCTATTATGTTTATAAATGTGTTGAAAAAATCTCTCCGTTAAACAGAAATTGGGGAAAAAAAATGATAAAGATTTTAATATAATTAGTAAGGTATGTTTATTGCTTATAAAATTAGATTTCTGAAACTTTTCTATATATAAAATACTATTTAATATATTATACTTTCAAATGTACAAATTCACAATTGTACAGCTACTGCTGCTCTTTTAATTATCCCAAACATAAACCCAAACATTTGAAAAGTGAACAGTACAATGCAATATAAACTTTCAGGTGTGAAATCATAAAGTTCGAACATTCATCAATCTTTTTCAGGTCGCTTGCTGAGGGCTAATCAAATCAGTTTTAACTGGGACCGGCTCGCATCTTGGATCAACCTGACTGAGCAGTGGCCGTA[T/A]CGCACCTCCTGGCTCATACTCTACCTAGAAGAGACCGATGGCATCCCAGATCAGACCAATCTCAAAACCATCTACGAAAGGCAATATCTCCATCACTCATTTTTTTAATAAATCCCAATGATTCCTGATGTTTCACTCTATCACCAAAAGCGAAATTCTTTACAGTCCTATCAAATTACAAGAAACATCTGTTGCTTTAGATCTTGAGATCAACAACTCAAGTCAATGCTAATCCGTACAATCTTATGTAATGCATTTTTGTCCTGTATGATTTCTTTTTGCATGTAGTTTGTTCATTAGCCCATTAGGGTCCTAGAGAAAAATGTCTCTTTAGGGAATCTTCCTGGAAAGAAATAATGGGAGGCCACAGAATGTCAGATGAAGCCAAGGAAAGCAGGCCCAGATCATTAGATAGGCTTCCCTACGGTGATTAGTCAGATGATGCGATTCCTGTAAGACTCGTGAAACTGCGCAGATATTGTCTTGTCTTCAGATGTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43465
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019181 Nonsense 1192 1672 26 28
ENSDART00000101603 Nonsense 1251 1731 27 29
ENSDART00000146366 Nonsense 1200 1680 26 28
Genomic Location (Zv9):
Chromosome 20 (position 29805934)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 29877147
GRCz11 20 29780026
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTTTGTGATTTTTTTTTTTCAGGCTAACATAAATGGCCGAGTTCTGTCT[C/T]AGTGCAACATTGATGAGCTGAAGAAAGAGATGAACATGAATTTTGGAGAT
Long Flanking Sequence:
CTCATATCACTCGTAATTTGCTCCAGCTTCTTCATCCTGCTGACAGCAATGGATTCAAAATGAATCGCATATTCTCCTCTTCTCTACCCCTTCTTCTATCCTTGAACGTTTCTTCAAGACCTTTTGCAACCCCTTACTACTGTTTTCTGCATGGTTTATTTCTTATGGTCTTCACGGCTTCAGAGATGCTTGATATACACACACTGCTGTGAATCTAGATCATTAACGTGTCTGTGTGTTGTGTACCAGGGCTCAGCTTCGGTGGTCTCAGGCACGCCATCAATTCTGCTCAGCTCGATGAGCACAGATGTCATCTGTGAGCGTGTCAAACTTATCGACGGTATCGATCAGAACCTGATTTCTCAGTATACAGCCACCATTAAGAAGGTATTTGTTTTTAGTACATTAAAAAAGAAAAATACATTAGGTTGTTTTACTCTACATCTTGTGGTTTTGTGATTTTTTTTTTTCAGGCTAACATAAATGGCCGAGTTCTGTCT[C/T]AGTGCAACATTGATGAGCTGAAGAAAGAGATGAACATGAATTTTGGAGATTGGCAACTTTTCAGGACATCAGTAAGTAGTGTCTCTGATTTATAGACTTTCTCAGTAGTAGGGCTTGCAAAGACTAGTCGACTAGTCGAGCGATCGACTACTTCAACCACTAGTCGACGCTCTCAGAAGCAATCGACTACTCGAACGTGCATTTACCATAAATAAAATCAAAACGACAAATTGTTGCTTGTTGAACTATTTTATTTCTGAACCAAAATAATTTTGATTCTTGTTATCACTGCTGGAAACTTAAATATTAGAGTTATTTTTTAAATCAGACTACTTGTTGTATAACAGACAATTACTTGCGCGCACATGATCGTTTGCATAATCTTCAGGCCGGTTGAAGAATATATATTCGTTTATTTTGTTATTTTAGTAACTGTTAAAACGTAGCAGAAATTAAATGATGGAATGAGATTTAGCCTAGCTCAGAATAATTTTATTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43466
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019181 Nonsense 1510 1672 28 28
ENSDART00000101603 Nonsense 1569 1731 29 29
ENSDART00000146366 Nonsense 1518 1680 28 28
Genomic Location (Zv9):
Chromosome 20 (position 29808305)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 29879518
GRCz11 20 29782397
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTCTGACTCTGGTGTCCGCTCCAACGAAAGCTCACCTAACCATTCGCTA[C/T]AAGACGAAGAGGCTGATCTGTCACAATCAGAGAGGGCTAACCTGATCGAG
Long Flanking Sequence:
AAAAACCGGTGCCACCTTTTGTTAGCCAGCTAATGCACTCCAGCTCTGAGGACAAGAAGAAGGATGGAAATGACCAGGATGGGCGCAAATCTGTTTCCAAACGAGGGAGCACCAAGTCTGGAAGCGATAACACAGATTACGCCTCAGCAGATGCTGCTACTTTAGATCCCATAACAGAAGAGGATGAGAAGGTTGACCATGGGTCATCAAAGTCCCTTTTGGGACGCAAAACATCTGGAGACAAGGTGAGCCTCTTTCAGGGAGCTGATCTGAAGTTGAAGGCTGGTGGAGGCTCACGTTACCAGAAACTGACCAGTGATGATGAAGAATCCGAAGAGTCTGATAATGCCCCTCTGCTTAAAGATGGAAAGAAACCTGAAGCCAAAGCCTCAGATGGCGGAGATCGATCTTTGACCAAAGGTAAAGATTACCTTTCGGATAAGAAGGATTCCTCTGACTCTGGTGTCCGCTCCAACGAAAGCTCACCTAACCATTCGCTA[C/T]AAGACGAAGAGGCTGATCTGTCACAATCAGAGAGGGCTAACCTGATCGAGCTGGACGAGGAGAACTCGGCCCGAAAGCGAGGCCTGCCGAATAGTCTGAGTGGCCTCCAAGACCCAACTATCGCCCGCATGTCCATCTGCTCAGAGGACCAGTGCAGTCTTCTGGCCAGCAGCCCTGAAGAAAGCTGGCCTTCCTCCAAGAGCTACAACCTCAACCGGACACCCAGCAACACCACCCTCAATAACAACACTAACGCCCAACAAGGAAACCACATTCGCCAACCGTCAGATAGCTCAAACACCACCTCCACCACCACTGGAAGCGATGTCATCATAAATCCTGGAACCAGCACCACCTCCGCAACCACCCAGAATGAAAATGTCCGCGTGGTGCATCTGAAGAGGGGCCTAAACCCTGGAGATCCTCCTGAGATCCTTAAAGTTTCCTCTGAAACCGTCACCTTCGGAGAGGAGCGAGAAAGTATCCTGTAGTTGACTAGA
Associated Phenotype:
Not determined