Busch Lab

ZMP

fbxw11b

Ensembl ID:
ENSDARG00000017230
ZFIN ID:
ZDB-GENE-040426-2903
Description:
F-box and WD-40 domain protein 11b [Source:RefSeq peptide;Acc:NP_998669]
Human Orthologue:
FBXW11
Human Description:
F-box and WD repeat domain containing 11 [Source:HGNC Symbol;Acc:13607]
Mouse Orthologue:
Fbxw11
Mouse Description:
F-box and WD-40 domain protein 11 Gene [Source:MGI Symbol;Acc:MGI:2144023]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2566
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019252 Nonsense 130 527 4 13
ENSDART00000140113 Nonsense 127 524 4 13

The following transcripts of ENSDARG00000017230 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 21533578)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 21494992
GRCz11 10 21452373
KASP Assay ID:
554-3259.1 (used for ordering genotyping assays)
KASP Sequence:
GATCATATAGCGGAGAAYATCTTGTCGTTCCTGGATGCTCGCTCGTTGTG[T/A]TCRGCTGAGCTGGTGTGTAAGGAATGGCARCGTGTCATATCTGAAGGCAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27592
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019252 Essential Splice Site 371 527 8 13
ENSDART00000140113 Essential Splice Site 368 524 8 13

The following transcripts of ENSDARG00000017230 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 21540715)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 21502129
GRCz11 10 21459510
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTGATGACAAGTACATTGTCTCTGCCTCTGGGGATCGGACTATAAAGG[T/G]CAGCACTTCAGTATGTTATCAGCTGTCAGTCAAAGCACAAATCAGTGCTC
Associated Phenotype:
Not determined