Busch Lab

ZMP

megf10

Ensembl ID:
ENSDARG00000017229
ZFIN IDs:
ZDB-GENE-030131-3302, ZDB-GENE-080506-1
Human Orthologue:
MEGF10
Human Description:
multiple EGF-like-domains 10 [Source:HGNC Symbol;Acc:29634]
Mouse Orthologue:
Megf10
Mouse Description:
multiple EGF-like-domains 10 Gene [Source:MGI Symbol;Acc:MGI:2685177]

Alleles

There are 11 alleles of this gene:

Allele Name Consequence Status Availability
sa13029 Nonsense Available for shipment Available now
sa21693 Nonsense Available for shipment Available now
sa6165 Nonsense Mutation detected in F1 DNA Not yet available
sa6166 Essential Splice Site Confirmed mutation in F2 line Not yet available
sa34867 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa34868 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa38788 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa30934 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa41612 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa34869 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13029
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043936 Nonsense 110 1119 5 25

The following transcripts of ENSDARG00000017229 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 16129082)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 16142389
GRCz11 10 16100508
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGACCTTACTCTCTCTTGTTTTCGCTGTAGCCCACTGTGCTGAGAAATG[T/A]GTGCATGGCCGCTGCGTGGCCCCCAACACCTGTCAGTGTGAGCCGGGCYG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21693
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043936 Nonsense 215 1119 6 25

The following transcripts of ENSDARG00000017229 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 16137788)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 16151095
GRCz11 10 16109214
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTACATGCCACCACATCACAGGCGAATGCGTGTGCAGTCCAGGATACACA[G/T]GAGCATTGTAAGTTTACCTGCATTTTTTTTTGCAAACAATAGAAGATGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6165
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043936 Nonsense 277 1119 8 25

The following transcripts of ENSDARG00000017229 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 16138287)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 16151594
GRCz11 10 16109713
KASP Assay ID:
554-5395.1 (used for ordering genotyping assays)
KASP Sequence:
GGACAACCCTGTCCGACGGGACGCTTTGGTAAGAACTGCTCACAGGAGTG[T/A]CAGTGTCWTAATGGAGGAATCTGTTCGCCATCCACAGGACAGTGTGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6166
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043936 Essential Splice Site 373 1119 9 25

The following transcripts of ENSDARG00000017229 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 16146816)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 16160123
GRCz11 10 16118242
KASP Assay ID:
554-4838.1 (used for ordering genotyping assays)
KASP Sequence:
GGCCTTAAGTGTGACAGGAAGTGCCCATGTAACACCAACAACACACGCAG[G/A]TGAGACAAACACTGCAAATATGTTTTCATCTTTTCAGTACTTACATGGCG
Associated Phenotype:
This allele has been associated with this phenotype by genetic linkage analysis and may not be causal.
See FAQs for more info.
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
degenerate
PATO:0000639
abnormal
PATO:0000460

Mutation Details

Allele Name:
sa34867
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043936 Essential Splice Site 740 1119 17 25

The following transcripts of ENSDARG00000017229 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 16175389)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 16188696
GRCz11 10 16146815
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGGCGAGTGTAAATGTACGGCCGGCTGGACAGGTCTCTACTGCACACAAA[G/A]TAAGTACCAAGTTCTTTTGCAATGATTCCCTTTCAATTACTAGCAGCTGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4365
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043936 Nonsense 744 1119 18 25

The following transcripts of ENSDARG00000017229 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 16175509)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 16188816
GRCz11 10 16146935
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAACATTTGGTCATGGCATTTCCTGTCTTCTTGTCCTGCAGGATGTCCAT[T/A]GGGTTTCTATGGTAAGGATTGTGTGCAGGCATGTCAATGTGAGAATGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34868
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043936 Essential Splice Site 783 1119 18 25

The following transcripts of ENSDARG00000017229 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 16175629)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 16188936
GRCz11 10 16147055
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGGTCAGTGCACATGCCGTACAGGCTTCATGGGACGTCACTGTGAAACGA[G/A]TCAGTATGGAAAAGAGCTTTTAAACAGTAGTTCTATTATTTGATAATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38788
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043936 Essential Splice Site 827 1119 20 25

The following transcripts of ENSDARG00000017229 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 16178293)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 16191600
GRCz11 10 16149719
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAAATTGTTTCTTATCTTTGACTGTGATGCTGCTGTTTTATGTGTTTCTC[A/G]GCTGGAGGGAATATTGCAGAAAGTCCCAATAGTTTGACAAGCGCAGCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30934
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043936 Essential Splice Site 1066 1119 24 25
ENSDART00000043936 Essential Splice Site 1066 1119 24 25

The following transcripts of ENSDARG00000017229 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 16184530)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 16197837
GRCz11 10 16155956
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTGAGATACATTCCTCCAGCCCTGCCAACAAAAATGTCTATGAAGTTG[G/T]TAAGCTGACAAGATTTATTGGTTTATTGGTAATTATAATGGTTTAAACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41612
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043936 Essential Splice Site 1066 1119 24 25
ENSDART00000043936 Essential Splice Site 1066 1119 24 25

The following transcripts of ENSDARG00000017229 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 16184530)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 16197837
GRCz11 10 16155956
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTGAGATACATTCCTCCAGCCCTGCCAACAAAAATGTCTATGAAGTTG[G/T]TAAGCTGACAAGATTTATTGGTTTATTGGTAATTATAATGGTTTAAACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34869
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043936 Nonsense 1090 1119 25 25

The following transcripts of ENSDARG00000017229 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 16189485)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 16202792
GRCz11 10 16160911
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGGCACTTACAAACAACAACTGCAACGGGCCATTCTGTCAAGATCCATA[T/G]GACTTACCAAAGAATAGTCACATTCCATGTCATTATGACCTACTGCCTAC
Associated Phenotype:
Not determined