Busch Lab

ZMP

npc1

Ensembl ID:
ENSDARG00000017180
ZFIN ID:
ZDB-GENE-030131-3161
Description:
Npc1 protein [Source:UniProtKB/TrEMBL;Acc:Q5BLA0]
Human Orthologue:
NPC1
Human Description:
Niemann-Pick disease, type C1 [Source:HGNC Symbol;Acc:7897]
Mouse Orthologue:
Npc1
Mouse Description:
Niemann Pick type C1 Gene [Source:MGI Symbol;Acc:MGI:1097712]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa19662 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19662
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103596 Nonsense 871 1276 18 25
Genomic Location (Zv9):
Chromosome 2 (position 4341960)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 4024213
GRCz11 2 3855102
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGAGACCCTGTGTATGAATGGTCACTGTATTGCTGTTTCAGGACTCATA[T/A]GTGCTGAATTACTTTGGGAATCTGAGCAAGTATCTACACACCGGGCCGCC
Associated Phenotype:
Not determined