Busch Lab

ZMP

wnt10a

Ensembl ID:
ENSDARG00000017155
ZFIN ID:
ZDB-GENE-990415-278
Description:
Protein Wnt-10a [Source:UniProtKB/Swiss-Prot;Acc:P43446]
Human Orthologue:
WNT10A
Human Description:
wingless-type MMTV integration site family, member 10A [Source:HGNC Symbol;Acc:13829]
Mouse Orthologue:
Wnt10a
Mouse Description:
wingless related MMTV integration site 10a Gene [Source:MGI Symbol;Acc:MGI:108071]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa41363 Nonsense Mutation detected in F1 DNA Not yet available
sa12206 Essential Splice Site Available for shipment Available now
sa41364 Nonsense Mutation detected in F1 DNA Not yet available
sa31702 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41363
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007308 Nonsense 147 442 2 4
Genomic Location (Zv9):
Chromosome 9 (position 11657474)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 11410039
GRCz11 9 11381242
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCATGAGTGCCAGCATCAGTTCCGAGGGCACCGCTGGAACTGCTCAAGTT[T/A]GGAGACCAGGAATAAAATCCCTTACGAGAGTGTGGTCTTCAGCAGGGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12206
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007308 Essential Splice Site 163 442 3 4
Genomic Location (Zv9):
Chromosome 9 (position 11662237)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 11414802
GRCz11 9 11386005
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AACTTTTGAAGGCAGCTTGCCTGAATAATCTATTGCATTGTTTCATTGGC[A/G]GGTTTCAGAGAAAGCGCATTTRCTTATGCCATTGCTGCAGCTGGTGTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41364
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007308 Nonsense 166 442 3 4
Genomic Location (Zv9):
Chromosome 9 (position 11662247)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 11414812
GRCz11 9 11386015
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCAGCTTGCCTGAATAATCTATTGCATTGTTTCATTGGCAGGTTTCAGA[G/T]AAAGCGCATTTGCTTATGCCATTGCTGCAGCTGGTGTGGTGCATGCCGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31702
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007308 Nonsense 344 442 4 4
Genomic Location (Zv9):
Chromosome 9 (position 11685368)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 11437933
GRCz11 9 11409136
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCGCTTCAACGTGGCCACGCTAATCAAAGCCCACAACAGAAACACAGGT[C/T]AGGTGGAGAATGCCCACCACACACACCGGCGGAGAGCCAACATCAATGAC
Associated Phenotype:
Not determined