Busch Lab

ZMP

zgc:63587

Ensembl ID:
ENSDARG00000017140
ZFIN ID:
ZDB-GENE-040426-1175
Description:
hypothetical protein LOC393431 [Source:RefSeq peptide;Acc:NP_956753]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa27129 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa6135 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa27129
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019828 Essential Splice Site 113 276 5 9
Genomic Location (Zv9):
Chromosome 8 (position 4882634)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 4618608
GRCz11 8 4674875
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGTTGTGGACACACCGGGATACGGAGACGCCATCAACAGCCAGGACTGG[T/G]AAGTGTGTGTGTGTGTGTGTTTACTGAGATAATGATGTGTGTTGTGGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6135
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019828 Nonsense 230 276 9 9
Genomic Location (Zv9):
Chromosome 8 (position 4822894)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 4565835
GRCz11 8 4622102
KASP Assay ID:
554-3827.1 (used for ordering genotyping assays)
KASP Sequence:
TGTGTGTGTGTTGTTTAAATGGGATAAAATTCAAGGATTTTGTGCCTAAT[A/T]GATGCATCTGGTCCAGTTTACAGTTTTATCAAATGCACATAATTGCGATT
Associated Phenotype:
Not determined