Busch Lab

ZMP

myof

Ensembl ID:
ENSDARG00000017128
Human Orthologue:
MYOF
Human Description:
myoferlin [Source:HGNC Symbol;Acc:3656]
Mouse Orthologue:
Myof
Mouse Description:
myoferlin Gene [Source:MGI Symbol;Acc:MGI:1919192]

Alleles

There are 9 alleles of this gene:

Allele Name Consequence Status Availability
sa35511 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa22321 Essential Splice Site Available for shipment Available now
sa22322 Essential Splice Site Available for shipment Available now
sa31933 Nonsense Available for shipment Available now
sa28125 Nonsense Mutation detected in F1 DNA Not yet available
sa28126 Nonsense Mutation detected in F1 DNA Not yet available
sa44787 Nonsense Mutation detected in F1 DNA Not yet available
sa10226 Nonsense Available for shipment Available now
sa31934 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa35511
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026000 Essential Splice Site 270 2045 8 53
Genomic Location (Zv9):
Chromosome 13 (position 29472124)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 29118072
GRCz11 13 29248522
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTCAACATGCTGCCTTCTGAGCTTTTTGATGAGAGCATCATGATCCGGG[T/C]AAGATGAGGCAATCCACAAGTTGACAATATTTCTTAATTAGCAATATATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22321
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026000 Essential Splice Site 533 2045 18 53
Genomic Location (Zv9):
Chromosome 13 (position 29480793)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 29126741
GRCz11 13 29257191
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGAATTTACTGGCCTACCTGACCCATATGAGGATCTGAATTACGGCAAG[G/A]TGAGTGTAGTAAAGAAAAATGTTGTGCTATGGGACTGACTGCTGAGAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22322
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026000 Essential Splice Site 630 2045 20 53
Genomic Location (Zv9):
Chromosome 13 (position 29482502)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 29128450
GRCz11 13 29258900
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGCAAACCACTGGCCTCTACTACTCAGTACAGCTGTGCTGTTTTTGATG[G/A]TGAGTTTCTCATAATGCCAGAGTGATAGCACATAAAAACACACTTAAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31933
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026000 Nonsense 667 2045 21 53
Genomic Location (Zv9):
Chromosome 13 (position 29482703)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 29128651
GRCz11 13 29259101
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCTGGGAGGACATAAGTCATCGTTTGGATTCAGTGAACATCATTCTGTA[T/G]ATTTCTGATCGACTGGTAGGATTTTAATCTTTATGCCATTCGGCAATTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28125
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026000 Nonsense 1250 2045 34 53
Genomic Location (Zv9):
Chromosome 13 (position 29492961)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 29138909
GRCz11 13 29269359
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCAACCCATTAATACCTAAACTCTTTTGGTTTCCCATCTCCTTGAAGGGA[C/T]GAAGTGCAGGGGAGATGCTGGTAGCAGCTGAGCTCTTGCTCAAAGAAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28126
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026000 Nonsense 1312 2045 36 53
Genomic Location (Zv9):
Chromosome 13 (position 29495173)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 29141121
GRCz11 13 29271571
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCATGCTTCGACAGATCCTGGCCTGGGGATTAAGAAACATGAAGGCATA[T/A]CAGCTGGCAGCGGTGTCTTCCCCCAGCCTGGTAGTTGAATGTGGAGGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44787
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026000 Nonsense 1444 2045 39 53
Genomic Location (Zv9):
Chromosome 13 (position 29502755)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 29148703
GRCz11 13 29279153
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATTCTTTCACCACCTATTATAGGAAGAGGACACGGTGGACTGGTGGAGT[A/T]AATTCTATGCCTCCATTAACGAGCTTGAGAAATGCGGCCCTTATCTCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10226
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026000 Nonsense 1555 2045 41 53
Genomic Location (Zv9):
Chromosome 13 (position 29504960)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 29150908
GRCz11 13 29281358
KASP Assay ID:
2260-6518.1 (used for ordering genotyping assays)
KASP Sequence:
GTCCTCAGGAGTGCCTGGTCAGAATCCAYAKCATAYGTTGCCTCGACCTG[C/T]AGCCTAAAGACAACAATRGCATGGTGAGTTTCCAGTGRTGTAAAGGAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31934
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026000 Essential Splice Site 2035 2045 53 53
Genomic Location (Zv9):
Chromosome 13 (position 29512467)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 29158415
GRCz11 13 29288865
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTACAGTATATTATGTGTGTTTTTAAATATTTGCCCTTTCATCTCTTTTC[A/T]GAACTACCTTTCCATGAAACTCGTAAAGCCATTTTAATAGGAAAAATTCA
Associated Phenotype:
Not determined