Busch Lab

ZMP

ilvbl

Ensembl ID:
ENSDARG00000017126
ZFIN ID:
ZDB-GENE-040426-1623
Description:
Acetolactate synthase-like protein [Source:UniProtKB/Swiss-Prot;Acc:Q6NV04]
Human Orthologue:
ILVBL
Human Description:
ilvB (bacterial acetolactate synthase)-like [Source:HGNC Symbol;Acc:6041]
Mouse Orthologue:
Ilvbl
Mouse Description:
ilvB (bacterial acetolactate synthase)-like Gene [Source:MGI Symbol;Acc:MGI:1351911]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa19208 Nonsense Mutation detected in F1 DNA Not yet available
sa10157 Nonsense Available for shipment Available now
sa36724 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa19208
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016271 Nonsense 23 621 2 16
ENSDART00000145190 Nonsense 23 242 1 6
ENSDART00000016271 Nonsense 23 621 2 16
ENSDART00000145190 Nonsense 23 242 1 6
Genomic Location (Zv9):
Chromosome 18 (position 43185980)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 44775871
GRCz11 18 44769325
KASP Assay ID:
2261-2579.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTAGGCTGCTCTCTGGGAGCTGCTCTTGGAGGTGTGATCTTTGCATCCTA[T/G]AAACTGGGCTTACTTTACCAGCTCTTTCATAAGGTAATGAGGATTGTAAC
Long Flanking Sequence:
GACTGCTATTCTCCAAATGAATTCACAGAACGCTGGCCGCGCGAGTACACTCAACTGCTCAAATAGCTGAGCGATTATTACGTATATAGCGTAACTCTCACATTCACCCAGTCCATTCAGAGCTTTCAGTTTGCGTGGCCCGTCAACAGGAGTGAGTTCATCGGCCTCAGCGCTGACTGCAGCAGGGGAGGAAAAGTTGGCACAGGTACAGTGTTTCCCTGACCTTAAACCAGGCTACAACAAGAACACACATGACAGCGCGTAGAAACATGACCGCCGTCTCGAGATTTGTCAAGTAACTGTACTGAAAAGTGCATTTGGAGCTTAGCGTCATTATAAGTATGTGGCTGTTTTGTTAATTTTACGCCTTTTTTATCGTCGGACAGGTCTCTAACAGGACAGGTGGGCGTCAGGTCGCAGAGCACCGTCGCGATGGACATATCCATGTATTTAGGCTGCTCTCTGGGAGCTGCTCTTGGAGGTGTGATCTTTGCATCCTA[T/G]AAACTGGGCTTACTTTACCAGCTCTTTCATAAGGTAATGAGGATTGTAACAGATATGGGTTATGAAATGTAAAGTTTTCACATCATATTGCAGCAACTTTTTGTTAACAAGTTGTCATAGAAACTGCCTTCTAAAACTAGTTAGTTTTATCTATCCATCTATCCATCTATCCATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATGCTTAATTACTTTAGCTATTCTGAAGTTGAAGCTGATCCATTAAGAAAGATCACTCAGTGATTTATTTTATAAATCAGACCTGATTATTTAAATTTGATCTTAATGTCTAAGTCTACAGTCTTCATTGGTTGTTGTAATTGCAAGAAAATTAACCAGTATGTTGCTGAAAATGTATATTATCTATAGCATTAATTGCTAAAATCAGTAGCCCTAAGTAGGGCTGCATAATATATTGTTTCAGCATCAATACCGCAGTGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10157
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016271 Nonsense 23 621 2 16
ENSDART00000145190 Nonsense 23 242 1 6
ENSDART00000016271 Nonsense 23 621 2 16
ENSDART00000145190 Nonsense 23 242 1 6
Genomic Location (Zv9):
Chromosome 18 (position 43185980)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 44775871
GRCz11 18 44769325
KASP Assay ID:
2261-2579.1 (used for ordering genotyping assays)
KASP Sequence:
TTAGGCTGCTCTCTGGGAGCTGCTCTTGGAGGTGTGATCTTTGCATCCTA[T/G]AAACTGGGCTTACTTTACCAGCTMTTTCATAAGGTAATGAGGATTGTAAC
Long Flanking Sequence:
GACTGCTATTCTCCAAATGAATTCACAGAACGCTGGCCGCGCGAGTACACTCAACTGCTCAAATAGCTGAGCGATTATTACGTATATAGCGTAACTCTCACATTCACCCAGTCCATTCAGAGCTTTCAGTTTGCGTGGCCCGTCAACAGGAGTGAGTTCATCGGCCTCAGCGCTGACTGCAGCAGGGGAGGAAAAGTTGGCACAGGTACAGTGTTTCCCTGACCTTAAACCAGGCTACAACAAGAACACACATGACAGCGCGTAGAAACATGACCGCCGTCTCGAGATTTGTCAAGTAACTGTACTGAAAAGTGCATTTGGAGCTTAGCGTCATTATAAGTATGTGGCTGTTTTGTTAATTTTACGCCTTTTTTATCGTCGGACAGGTCTCTAACAGGACAGGTGGGCGTCAGGTCGCAGAGCACCGTCGCGATGGACATATCCATGTATTTAGGCTGCTCTCTGGGAGCTGCTCTTGGAGGTGTGATCTTTGCATCCTA[T/G]AAACTGGGCTTACTTTACCAGCTCTTTCATAAGGTAATGAGGATTGTAACAGATATGGGTTATGAAATGTAAAGTTTTCACATCATATTGCAGCAACTTTTTGTTAACAAGTTGTCATAGAAACTGCCTTCTAAAACTAGTTAGTTTTATCTATCCATCTATCCATCTATCCATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATGCTTAATTACTTTAGCTATTCTGAAGTTGAAGCTGATCCATTAAGAAAGATCACTCAGTGATTTATTTTATAAATCAGACCTGATTATTTAAATTTGATCTTAATGTCTAAGTCTACAGTCTTCATTGGTTGTTGTAATTGCAAGAAAATTAACCAGTATGTTGCTGAAAATGTATATTATCTATAGCATTAATTGCTAAAATCAGTAGCCCTAAGTAGGGCTGCATAATATATTGTTTCAGCATCAATACCGCAGTGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36724
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016271 Nonsense 165 621 5 16
ENSDART00000145190 Nonsense 165 242 4 6
Genomic Location (Zv9):
Chromosome 18 (position 43192905)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 44782796
GRCz11 18 44776250
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCCAGGATATCGACCAGATGTCTCTCTTCAAGCCTCTCTGTAAGTTCTG[T/A]GCATCAGTGAGGACTGTGAGAGAAATAGTTCCCACTGTTAGAAAAGCCCT
Long Flanking Sequence:
ACCCTATTCAAACACACCTAAACAAGCTAATCAAGGTCTTACTGGGTATACTTGAAACATCCTGGGAGGTGTGTTGAGGCAAGATGGAGCTAAACCCTGCAGGGACACCGGCCCTCCAGGACCAGGATTGGTGACCCCTGGTCTAAAGTGACATTTTTGAAAAAAAAACAAAAAAAAAAACAGTCATTTTATTTGCCAATAACCTTTTCATTACATATAAAATAAACTTCTAAACCTAATCAGAGGAGCCTGAAATGCTCATTTACAAGAAAAGCGGTCAGATGGATTTAGAGGTTTTTGCATCTGAACTCTTCTTATAGTATTGCTGCAGTAAATATCACAATACTAGTATGCTGTATCGATATCCCCCTCCCTATACTGAATATGTCCTTAAAATATGTTTAATCTAAAAGACTTAGATTTTGTGTTTCTTTGCAGGGTAGAGGTGCACTCCAGGATATCGACCAGATGTCTCTCTTCAAGCCTCTCTGTAAGTTCTG[T/A]GCATCAGTGAGGACTGTGAGAGAAATAGTTCCCACTGTTAGAAAAGCCCTGGCCATCGCACAGTCTGGAACACCAGGTACAGTGGCATTGATTTGCATTATACATTTTTTTTTTACAAGTGTTTTTGTTAGATTTACATTTTTCAATATTTACCAAACAATAAACTAAAATAAATAAATAAATAAAAATTATTATTATTATTATTAAAAAAGAACAATCAGGGCATATAAACAGTTTCAATGAGGCAGTCAATAGGGTCAGTGAGCATGTTAAGGCCCAATTCTATTTTTGTACCCCTTCCCCTTCCCCTTGGCCCTTAAAACTGAGTGTGAAGGGGAAGGGCTTCAAAATTTACCCCTAAGAAATGGGACAGCACTACAACACCTGCACACATCATCAGATGTCATCGCGATCTCTTGCTTCATATGAGATCAACGATGGTGACTGTTGTAGTTATTCTAGTTTTGGTATTTATTTTCAGGAATTCACTGAAGGCATAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1650
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016271 Essential Splice Site 527 621 14 16
ENSDART00000145190 None None 242 None 6
Genomic Location (Zv9):
Chromosome 18 (position 43205191)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 44795082
GRCz11 18 44788536
KASP Assay ID:
554-1590.1 (used for ordering genotyping assays)
KASP Sequence:
GTTCTCTCGGATATACAGTGGCTGAATTTGATACCTTYACACGCCACAAG[G/A]TAGGATCCATAATAAATGCAACAAKACTTTTACAGAATTAAGTTAAGAAT
Long Flanking Sequence:
CACCACATGTGGATCCAAAGTGCCGTTCAGTTAAAAGAAAACAGGAACAAGAAAAATTGACATTTATTGTTAGTCAGCTCGCACATTATTAAAACAGTTAATAATTAGCACATCATCGTTGATATCGTATGTCTGAGATTATTTACTAAATAATATAGAAATAAATGTTTTAATGCAATATCATGATAAGCTCTGTTTATTAAACCATGACAGTATTTCAGTATTTGTGTTCATCATGACTACTCTGTGCATCAGGGGCTTTTGGGACTCTGGGTGTTGGAGGAGGATTTGCTCTGGGAGCAAAGCTTTGTCGACCTGAGTCTGAGGTAAAATAAGATTATTGTTTATTTATTCATTTTTTCCTGATCTTATTTGCAGACTTTATCTTGTTATAAGAATGCATGTAAAAGCTAATTTGTCGTTTGTAGGTATGGATTGTTTATGGCGACGGTTCTCTCGGATATACAGTGGCTGAATTTGATACCTTTACACGCCACAAG[G/A]TAGGATCCATAATAAATGCAACAAGACTTTTACAGAATTAAGTTAAGAATGTATTAAAATGTGTTCTGCTAGGACAAAACGCTAGCTTGTGTGAAAACTCTGTGGTAATTTTTGAGAGTGATGATAATGATCTAATCCGATTCAATGGTTTAAGCTAAACTAAGCTAAGCCAAAAGTGCTTCCACCCAGACCTGGAGATCGGCTGAATGGATTAATAATGGTAAAATTCAGCTTTTGGGGAGTTACAACATAAGCCTATTTATGAAAATAGGGGGGTTTGATTGGTGACAACCCGCGAGAGAGATCCTAATGGTTTAATCCAATTCAATGATCTATGCTAAGCTAAGCTAAAAATGCTCTAACCAGACCTGAATGGATTACAAAATGGTAAAACTCAACTGTAAAATAGTAATTTATCTGAATCAAGTTGTTTAAACCAAGTAAGCTTCAAGATTAGACAATGTGTTTATGTAAATAAAAGAGTCAATTAAATTATATTT
Associated Phenotype:
Not determined