Busch Lab

ZMP

vps37a

Ensembl ID:
ENSDARG00000017119
ZFIN ID:
ZDB-GENE-030131-8312
Description:
vacuolar protein sorting-associated protein 37A [Source:RefSeq peptide;Acc:NP_956284]
Human Orthologue:
VPS37A
Human Description:
vacuolar protein sorting 37 homolog A (S. cerevisiae) [Source:HGNC Symbol;Acc:24928]
Mouse Orthologue:
Vps37a
Mouse Description:
vacuolar protein sorting 37A (yeast) Gene [Source:MGI Symbol;Acc:MGI:1261835]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa16986 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16986
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078675 Essential Splice Site 204 387 5 12
Genomic Location (Zv9):
Chromosome 1 (position 15212377)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 15777545
GRCz11 1 16470482
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACGGACTCATCACAGACCTTCCACTTCCTGTACCAACTGCTGACTCACAG[G/A]TACCGCTYAGTCCAAGATGAGCTAATTGGTTTATTCCAATTCCAGTKACT
Long Flanking Sequence:
GAAATACGTTGAGACCATTGTTTACATCCATCAAAATGGTCTAAGGTGTAAACAGTTCCATTAGCATAATATTGTACCATTTTCTTTTTTCCTTCTCTCTAGTTTGGAATGCATTCAGATTTAGGCAAAGTAATTCAGAGTTTGCTAGATGAGTTCTGGAAAAGTCCTCCGGCCTTGACGTCAGATCCCACCTTTCCTTAGTGAGTATTTATCACCTTCTTACTGCAAGTTAATTCACATCTAATAAGGAAGATCTCTGATTTGTGTTTTTGTTTGTTTTGCCCCTCAGTATGTACAAACCATCGGCAATGCCCCCTTACCCAACACAGAGCTTCCATTTTGTTCCTGCCTTCCAACCTCAGGATGGTCAGCGGCCGATTGGCCCAGCCCCTGTGCCACATGCAGGGATGGAGCCTCAACAAGCCCCTCCTAGACCAGCAGCACCAGCTTACGGACTCATCACAGACCTTCCACTTCCTGTACCAACTGCTGACTCACAG[G/A]TACCGCTTAGTCCAAGATGAGCTAATTGGTTTATTCCAATTCCAGTTACTGTATTTTTACACTCCTGTGTCTAGTGACACTTGCTAAAATTATGCGTGATTTTGAGTACTTGTGCTTTTTACAGTGGACAAAAAAAGTATTTGAATTCATTTCAGATGCCAATTCAAAACAAAACTATGAGATTACAGATTTGATTTGAAATCATTTGAATTAAAGTGTATTTAAATGAATTTCTGAAGTCAAAAGTAGGATTCATAATATTGTGAATATAGCAAAACTGAAACTAGAGGTCATACATTTGTATGTGTCAAAAAGTTTATGATATTTGCCACCAGCCACATATCCTGGTTCAGTCACGAAGGTGCCTCGAAACTTGCTTTGACAATAATCCTTTTTTTTATATAACCCTTAAGGAGGATCTATACAATCGGTGTAAAACTGTGTGGTTTAACTGTACATCAAGTATCTGAGACTATTTATGCCCTGCTTTATTGAAGCCC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4835
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078675 Essential Splice Site 228 387 6 12
Genomic Location (Zv9):
Chromosome 1 (position 15214983)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 15780151
GRCz11 1 16473088
KASP Assay ID:
554-3579.1 (used for ordering genotyping assays)
KASP Sequence:
ACAAGATGCCTGATATCCCAGATACATTTTCAGAACTATCTGAGATGAGG[T/G]ACGGTACTTCAAAACATTTCTTSTCTTGCATCTGTTTTTTTCTGCTATGT
Long Flanking Sequence:
AATAATTAATCTTTTACAACTTTTAAATCAGATTCTAGTTATCTGATTATTTTGATATACATCACAATTTAGCTTGCCATATAATTTAACAAATTCTTAACAAACTCATAATTATTAATTACCAAATAATGATTGAACAAAAGATTGGGCATATTTGTTTTTTGTCACTATAACACATAGCATATTTAATTTAGTTCTGAAAATGAACCATTTTTAATCAATCAACATTGCAATTTTTATGAACCAGCATTCAATAATGGAGTACATTACTGTCGCTTTGTTAAAAAAAAAAAAAAAAAAGATGTCTATCCAGTCTAATGCACACAGTCGGCATGCAAAAACGGACCCACAAACATTTTCTATTCATTAAATCAAAAGCACTGTGCAATAACCTATAAAGGCTCACTCTTGCTGTTCTTCCTTTGTAGTCTGGCCTGAATGGACACATATACAAGATGCCTGATATCCCAGATACATTTTCAGAACTATCTGAGATGAGG[T/G]ACGGTACTTCAAAACATTTCTTCTCTTGCATCTGTTTTTTTCTGCTATGTTTAAGGTAGATTGCTAAAACATGTCAGTTGCTTTTTCCTATTTTCTTAAAGTGGCCCTATTATACTTATTACAACATTACCTTTCATGTAGCACATGATATAGCTACTTGTGAGTGTAAAAGCTTTGCAAAGTTTCAGTCATCAAAGTACTCAATAAATGGAGCTATTTTCCCCAAGAATAAAAAGAACCAATTCTGAGCTGCCAGAAATGAGCTTATCAGTAAATCTAGTTTACTTCCAGTACAAAATATATGTAGTTTTTAACAAATTTGCATAATGTCAGCCTATGGTCTTAATTGGCTGCCTACTGATAATGATTAATTTGACCCTTTAAGCACTTGTTGTAACTTAGGCCTTGAAGATTGTGGTTTGTGTTGTCGATAAGATGGTGTTTTCTGAGCTTCGAATGCAAGTACAAGTACTTTGTTGTACAAAAATCACAACAAACTG
Associated Phenotype:
Not determined