Busch Lab

ZMP

vasp

Ensembl ID:
ENSDARG00000017105
ZFIN ID:
ZDB-GENE-030131-7118
Description:
vasodilator-stimulated phosphoprotein [Source:RefSeq peptide;Acc:NP_001017790]
Human Orthologue:
VASP
Human Description:
vasodilator-stimulated phosphoprotein [Source:HGNC Symbol;Acc:12652]
Mouse Orthologue:
Vasp
Mouse Description:
vasodilator-stimulated phosphoprotein Gene [Source:MGI Symbol;Acc:MGI:109268]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa23365 Nonsense Available for shipment Available now
sa15540 Essential Splice Site, Missense Available for shipment Available now
sa16008 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23365
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042473 Nonsense 82 185 3 6
ENSDART00000098862 Nonsense 83 411 2 19
ENSDART00000098865 Nonsense 82 445 3 14
ENSDART00000133797 None None 96 None 6
Genomic Location (Zv9):
Chromosome 18 (position 39089509)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 40802226
GRCz11 18 40792418
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATTGTAAAGGGATTAAAATATAATCAGGCCACGCCAAACTTCCACCAGT[G/A]GCGGGACGCCCGGCAGGTGTGGGGACTCAATTTTGGCAGCAAGGAAGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15540
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site, Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042473 Essential Splice Site 140 185 None 6
ENSDART00000098862 Missense 142 411 3 19
ENSDART00000098865 Essential Splice Site 140 445 None 14
ENSDART00000133797 None None 96 None 6
Genomic Location (Zv9):
Chromosome 18 (position 39089244)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 40801961
GRCz11 18 40792153
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GRCCTGYGTCTAATGGACCATCACCAGAAGAGCTGGAACAGCAGAGRAGG[T/C]ACAGGCCTGGGGTCGAAATTAGACTGGGGTTTATTTTATTTYCAGAATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16008
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042473 Splice Site None 185 None 6
ENSDART00000098862 None None 411 None 19
ENSDART00000098865 Nonsense 178 445 5 14
ENSDART00000133797 None None 96 None 6
Genomic Location (Zv9):
Chromosome 18 (position 39082703)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 40795420
GRCz11 18 40785612
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
KAGAACGGCAGGAAAGGGAAAGACAAGAGAGAGAAAGACWAGAGAGAGAA[C/T]RACAAGAGAGAGAACGGCCAGTAGCTTCAGGTCAGCAGAAACTCTTTTAC
Associated Phenotype:
Not determined