Busch Lab

ZMP

ENSDARG00000017036

Ensembl ID:
ENSDARG00000017036
Human Orthologue:
SVIL
Human Description:
supervillin [Source:HGNC Symbol;Acc:11480]
Mouse Orthologue:
Svil
Mouse Description:
supervillin Gene [Source:MGI Symbol;Acc:MGI:2147319]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa20089 Nonsense Available for shipment Available now
sa38405 Nonsense Mutation detected in F1 DNA Not yet available
sa40124 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa9049 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa20089
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022393 Nonsense 22 1533 1 29
Genomic Location (Zv9):
Chromosome 3 (position 39147197)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39010557
GRCz11 3 39152415
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCAGGAGTCCAGAGCTGAACGGATCGCTCGCTACAAAGCAGAGAGGCGG[A/T]GAGAGCTGGCAGAACGTTACGGCAGCCAAGAAGAGGAGCTTCCATCAAAG
Long Flanking Sequence:
GAGGAAACCCACGCGAGCACGGGGAGAACATGCAATCTCCACACAGAAATGCCAACTGGCCTAGCTGGGACTTGAACCTGCGACCTTCATGTTACTGACCTAAGAAATAACAAATAACCAGGAACTGTATTTTAAGCATGTTGATTCTTGAATGAGGGTGTTTTCCTGTCCTCTTTTTCATCTAAAGATATGTGACACCTATATTCATTAAACTTTCTCTTTTAACTAAGAACTCTTTCATTTATTTCAACAGTGCCATGTCCTCGGGGAGATGATCAGGATGAAACACAAACATATTATAAGAACCTGCTGTTTTTTGAGCTTCTGATTAATCACTTTCAGTTGTGACTCCACCCTTGTTTTCCAAAACGATTACCTGCCAGGAATTATTCTGCATAATTCAGACACCCTAAGTGACAAAACAGGAGTTAGACAAAATGGAAAATGTAAGCCAGGAGTCCAGAGCTGAACGGATCGCTCGCTACAAAGCAGAGAGGCGG[A/T]GAGAGCTGGCAGAACGTTACGGCAGCCAAGAAGAGGAGCTTCCATCAAAGTGGTCTAAAAGAGAGAGGGAGGGTCGTGGCATTCGTGACTCTAGCTTTGCGGATACGTCTGTTTCTGGTGGAATAAATGGAGGGACAGGGAGGAATGGACGAGCAACACTGGAAGAGAGGACTGCAAAGATTTCCAATGGATATAAGATGGATACCAGTGGAGAAAACACAAAGAACAGGTGAGATGGCCTGAGACTTTATAGCATACACAGATTTGTGTCATCAAATAGTTTACCTGATATTTCTATTTAAACGATCAATTATAGCAATTAAAAATGCATCTTTGAAAGTAAAATTGCATATAGCAAAAATGAACTTTTTAATTGATGTTTGAAATGACAGATTAAAGATAAATATGTTTGAAATATAATTTAAAGTATTTTTACTTGCACAAAATGCATTCATAATTTTATTAGTTAAGGATTCTTAATTAAGGATTTGTTAGTAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38405
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022393 Nonsense 966 1533 19 29
Genomic Location (Zv9):
Chromosome 3 (position 39119352)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 38982712
GRCz11 3 39124570
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAAAGAAAGCTGGCCCTTCAGCTGGCTCAGCAGGTTTGGGACGGAGCGTA[T/A]GATTATAGCAACTGCAGGATCAATCCTCTGGATCCCTCTGGTGGCAGTGC
Long Flanking Sequence:
TAGAAGTGCAGTGTTTTTTTAATGCCAGCTATGTAGCGAGGCTCTGATTGTGCGCTTTATGCTCAGCTCTGAGTGCTCTGACAGTTTAAGAAGCGCTTGCAGTTGATCGTTTATAGAATGGCACTGACATTTTAAGTGAACACACACTTAATTTCAAATTTGCTTCTACGCAGTTGAATTTCTTGTTTATAATATAAAATTTTTAATTTGTATATATTTTTTATTAAATGCAATGAACTCTCATCAATAATTGAGTGAAATGAGTTAATTTCATCACATTAAATTTAATGTTTGGTACACTTTACCTGGAATTGTTTTGTGATTCAACATGGCAGAAATGCATTTGTGCTTAGTGAAATGGACTTACAGTGTATTTGTCTGTTTCAGACTCTGCTGTTTGACTTCGGCAGTGAGCTCTATTTGTGGCATGGGAAAGACGTCGGCCCAAGCGAAAGAAAGCTGGCCCTTCAGCTGGCTCAGCAGGTTTGGGACGGAGCGTA[T/A]GATTATAGCAACTGCAGGATCAATCCTCTGGATCCCTCTGGTGGCAGTGCCCACATTCACAAGTAGGTTTAGCATAGGGGAGCATTTTCAGAAATTCTGAATAAAAGTCCACAGTTGAAAATGCTTCTTTTTTTCCGATTTTTGGTAATGAGTATATATATTTTGTTTTATTACAAACTATATTATCAGTATAACATTTTGTATCATAAATTCTCCTTGCTTTAACGAGGCCATAATATGGTACGGTTTTAACCCTGTTGGTTGTCAAACTTAATACATTTTGACAGCTGTATATGTTGATATAGTGGCTCAGTGGTAAGCACTGTCACCTTACAGCAAGAAGGTCGCTGGTTTGTGTCCCGGCTGAGCCAGTTGGCATTTCTTTGTGAAACTTCAACATTTAAACCTGGTGCCATTTTAGCAGGAAGTCAGCACAAAGTCTTTGATAGTAGACCTTCAGTTTGACCAAAGGGCTTTAAAATTATAACTGCTTATATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40124
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022393 Essential Splice Site 1037 1533 20 29
Genomic Location (Zv9):
Chromosome 3 (position 39118379)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 38981739
GRCz11 3 39123597
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAGCATGAACAAAAACCACATCGTTCCTTCAATACAAGAGGAGGTGAAG[G/A]TGAGGAGACTGACAGACTGTACACTTCAAGAGTTCACACTTAGCTGATGA
Long Flanking Sequence:
GCTTTAAAATTATAACTGCTTATATATTTTTACTATGTTGGCACAATTGTTTCAGGTTTGACATTTGGAGGAAACAGTCACTTCTTTCTTGTTTTTTGCTTTTGAACAGCGCAGTATAAATTAGTAATAATTATGTAATTATAATTATGTGGGTATATTTGTTTAATGGATATAAATTTTGTATTTATATGCTAAGAGATTTCAGTGTGTGAATGTTAGTTTTTTATTATGAAAAAGTTAATGCATCACAACTTTTGGACTTTTCGAACAAGGCAATGGTGGACATAGTGTAAATAACTATTCCATTGGCCTATTGTTTTGTTCACAAACAAATATTCTCTGTGTTTAGACAGGGTATTGGACGGCCAGACTGGGCACTTTTTGGCCGTGTGTTCGACCAAAATGAGACGATACTCTTCAAAGAGAAGTTTGCAAACTCATTTGAGCAGACAAGCATGAACAAAAACCACATCGTTCCTTCAATACAAGAGGAGGTGAAG[G/A]TGAGGAGACTGACAGACTGTACACTTCAAGAGTTCACACTTAGCTGATGATTGATGATAAAGCGTATTTGGCAATCATAAAGCATGTGATCCTCTCGAAATTAGTTTATAAATAAACTTCACAAGTTTAGATAACAAACATATTTTCATGTTCTTCTTTTGTTTAAATGACTTCCATAATCAGTTATTTTAAACAGCAGTTTTTCCACATTTTTAAAGTTTTGTTTTTGTTTACTCTCTTTCTATCGTTGTAATGTCTATCATCTTCTCTTCAGACCGCTTCCAGTCTCCATCAAGCATCAGCGGAGCAGTGGTCCTGTGATGTTAGAGCTCTTTTTGGAGGGGTGTGTCTCTCAGGAGTGTCTCAGGTCATTCTGGATGGTGTGGATGTGCGAAGGGGACGGGACTTGGTCACTTTCAGTGATGGTCGGCAGGCAGATCTAAGCACTGTTTCTGTGAAAGTGTGGCTGATTTCAGAGGGTGGGGATTGTGAAGTTGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9049
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022393 Essential Splice Site 1207 1533 23 29
Genomic Location (Zv9):
Chromosome 3 (position 39113150)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 38976510
GRCz11 3 39118368
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAGACAGACAGCTCCACTTATTGCATGTGACAGTGTGTTTGGTGTGTTTC[A/G]GAAGCCTGGCGTCTGTTCTGTGTGAGGGGTGATGTGCCGATAGAGGGCAG
Long Flanking Sequence:
CAATCAAAGTGTTTCGCCAGACTGTTTTTATCAAGTGTGATTATAAAAAATAAAATTCAGATATTTTTACCATTAGAAACTGGTTATATTCACACACTGTTGCCACAAATCTGTGTTTAAACCCTTTATAAAAGTGATTTTTGCATAAAAGTTTCTTTTTAAATAGTCTATTTTACTTACCTCACTGGCGGATTATTTAGCTTGTTTTAAGGAAAAGCCTTTATGTTCAAATGTTTGGACTGGAACCAGATGAAAACCATAAGTAAGAAAAGCATTTTTGCTGTAAAAAACAAAACAAAATTAACCTCTAAATTCATTTCACCATGTATATGGATTATTTGTTGCACAACCTTGTTATTTGAATTGATTAGTTTCACTTCTGTTAAATGGAAGTTCCTCAACCCAGAATTGCAATCCATAACTTGAAATACAAAAGTTACTTGCAGAAAAAAGACAGACAGCTCCACTTATTGCATGTGACAGTGTGTTTGGTGTGTTTC[A/G]GAAGCCTGGCGTCTGTTCTGTGTGAGGGGTGATGTGCCGATAGAGGGCAGCCTGTTGGAGGTTCAGTGCTCCTGCTCCAGTCTGAGATCTCGTGGCTCATTGGTTCTGTTGAACAGCCAACAGGGCACCATCTACCTGTGGCATGGGTGTAAAGCCCATAGTAAAGCCCGTCAGGTGGCCAAGCACACCGTCCAGCGCCTCACACAAACGTGAGCTGCACCTCTGTCAAAAGAGTCATGTAAACAAACCCATGAAACACATTAATTGGTGCAAGTTGCCAGATTGGGACTGATATCATGTGATTGATGTGTGATGATCAGGTGCCCATCTGAGCTGAGTCTGAAAACTGGCAGCTTTATGAACATCCAAGAAGTGGAGGAGGGGAAGGAGCCTTCCGAATACTGGAACGCTATTGGACAACAGGACAGGAAGTCATATGACTGCATGCTACAAGGTATGGTGAATAATAAACTAATAGTGCATCTCAATCAGCCTACTAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5218
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022393 Nonsense 1371 1533 25 29
Genomic Location (Zv9):
Chromosome 3 (position 39111222)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 38974582
GRCz11 3 39116440
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTGTCATCACAGCAATGCCCTTCCTTCAAGATAAGCTATACACTGTGCCA[C/T]AACCAGGTAAGACCATCCACGCACAGAAACAAAGTACACATGAAGGCTTT
Long Flanking Sequence:
AGAAAACATGAAGAATTCATATCCTGAGACTGAATAATAGTCAAAACGACTTTCAATAAAATATGTAATATGTACATGAAATAACATTTAAAAAATTGTATCTGTAAAATATAAGTTCTGTTGTTGTTTATAAACACCCACCAAATGTCCTACAGTGCAGATGTTGTCATGTCACCATCAGTGTCTCAATGTTAGTGAGCCTGATTCTTTACTGGTTGGACACACTGATTCCTGACCTCAAGAATTAGAGCACTGATTGAAGTGTGACTTGTTAAATCGTGTTGTCATTATTTTGTAGTGCAATGAACATTTGCATCATTTTTCACAAGAGGTCTTCTTTGTGTTCCTCAGATCCTGGTAAATTTAACTTTACGCCCCGCCTTTTTCACCTGAGTGCCCAATCAGGATCTTTTGAAGGACTGGAGCTCGTTAGCCCCTGCCGTGCAAATGGTGTCATCACAGCAATGCCCTTCCTTCAAGATAAGCTATACACTGTGCCA[C/T]AACCAGGTAAGACCATCCACGCACAGAAACAAAGTACACATGAAGGCTTTCCATGCTGCACTTAATGGTAGAGTTCAACCAAAAATGATGCATAATTTTTTAATTATATAAAAATGTGCATGTTATTTGAAACCCATAGACTTAAACCCATTATTAAAACCATTAAACCTAATTTCTAGATTAATTTAGAAACATAATACTGAAATTTATAAATAAACAATACATTGAAGTCTTTTTAAGCAAAATGATCACGCTGTTCAAGAAAATGAACATTATTTACAATATTTGCCACAGGGATTTATTTGGTTTTCCCATAGGTTTTTGACTTTCAAAGTGCCAGTAATCGCTGACTTGCATTTACTGAATCAATTCACAGTTTTTAAATGTTCTGCTATATAAATAAAATGTCCACAACATTTTGGATTTCCTGATTGTGTTAAATGAATAAAAAAATTTATTCCTAGATGAACTGTCTCTTTAAATATGCAGTACGCTATATT
Associated Phenotype:
Not determined