Busch Lab

ZMP

scamp2l

Ensembl ID:
ENSDARG00000017010
ZFIN ID:
ZDB-GENE-030131-6432
Description:
secretory carrier membrane protein 2, like isoform 2 [Source:RefSeq peptide;Acc:NP_957488]
Human Orthologue:
SCAMP2
Human Description:
secretory carrier membrane protein 2 [Source:HGNC Symbol;Acc:10564]
Mouse Orthologue:
Scamp2
Mouse Description:
secretory carrier membrane protein 2 Gene [Source:MGI Symbol;Acc:MGI:1346518]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa16241 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27067
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024076 Nonsense 139 325 5 9
ENSDART00000140702 Nonsense 130 143 5 5
Genomic Location (Zv9):
Chromosome 7 (position 58359847)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 56795173
GRCz11 7 57096584
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCCAATCAAACCTTGCTTTTATCAGGATTTTAATGAAGAAATTCCTGTG[G/T]AATATCAGAGGGTTTGCAAGATGATGTACTACCTCTGGATGTGTAAGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16241
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024076 Essential Splice Site 279 325 8 9
ENSDART00000140702 None None 143 None 5
Genomic Location (Zv9):
Chromosome 7 (position 58365976)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 56801302
GRCz11 7 57102713
KASP Assay ID:
2259-9598.1 (used for ordering genotyping assays)
KASP Sequence:
CTGGATTYTTCACTGTCAATGCYGTRTTCTCTGTTATCTTACTGAAAATG[G/A]TAAGTTGRTTACAGTTGTGGCCATGTCTGCATTTGTTTATYATTTTGCTA
Associated Phenotype:
Not determined