Busch Lab

ZMP

nr4a2a

Ensembl ID:
ENSDARG00000017007
ZFIN IDs:
ZDB-GENE-040718-103, ZDB-GENE-990415-184
Description:
nuclear receptor subfamily 4 group A member 2 [Source:RefSeq peptide;Acc:NP_001106956]
Human Orthologue:
NR4A2
Human Description:
nuclear receptor subfamily 4, group A, member 2 [Source:HGNC Symbol;Acc:7981]
Mouse Orthologue:
Nr4a2
Mouse Description:
nuclear receptor subfamily 4, group A, member 2 Gene [Source:MGI Symbol;Acc:MGI:1352456]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27334
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109954 Nonsense 75 635 1 6
Genomic Location (Zv9):
Chromosome 9 (position 5051036)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 5078587
GRCz11 9 5045018
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTACAGTTACCACACAAGCGGAGAATACAGCTGCGATTTCCTCACGCCA[G/T]AGTTTGTGAAGTTCAGCATGGACTTGACCAATACCGAAATCACCGCCGCC
Associated Phenotype:
Not determined