Busch Lab

ZMP

snx27

Ensembl ID:
ENSDARG00000016977
ZFIN ID:
ZDB-GENE-040426-1529
Description:
sorting nexin family member 27 [Source:RefSeq peptide;Acc:NP_956834]
Human Orthologue:
SNX27
Human Description:
sorting nexin family member 27 [Source:HGNC Symbol;Acc:20073]
Mouse Orthologue:
Snx27
Mouse Description:
sorting nexin family member 27 Gene [Source:MGI Symbol;Acc:MGI:1923992]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa42715 Nonsense Mutation detected in F1 DNA Not yet available
sa10389 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa42715
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021092 Nonsense 188 569 3 13
Genomic Location (Zv9):
Chromosome 16 (position 25744492)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 23590167
GRCz11 16 23505199
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCCCGGATAATTTCAGAATTATTTTCCTTTATTGTGTGTGTCAGGTCTA[C/A]AACGTGTACATGGCAGGCAGGCAGTTATGCTCAAAGCGCTATCGGGAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10389
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021092 Essential Splice Site 308 569 6 13
Genomic Location (Zv9):
Chromosome 16 (position 25752659)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 23598334
GRCz11 16 23513366
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCAGTTTCCAAATCCACACATTYTATTCTTCCTCACTGTTTCTTTTTTCA[G/A]GCCGTAGTAACAAAGATTGGGATGGACAGCATTACTGCAAGTTATTTTGC
Associated Phenotype:
Not determined