Busch Lab

ZMP

Q7SYK4_DANRE

Ensembl ID:
ENSDARG00000016968
Description:
LOC402840 protein [Source:UniProtKB/TrEMBL;Acc:Q7SYK4]
Human Orthologue:
TMEM214
Human Description:
transmembrane protein 214 [Source:HGNC Symbol;Acc:25983]
Mouse Orthologue:
Tmem214
Mouse Description:
transmembrane protein 214 Gene [Source:MGI Symbol;Acc:MGI:1916046]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa16542 Nonsense Available for shipment Available now
sa40194 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa30843 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa16542
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128743 Nonsense 367 675 9 16
Genomic Location (Zv9):
Chromosome 4 (position 478972)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 758828
GRCz11 4 772276
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACACTGCACACATATTTCCCATCATTCCTGTCACGAGCCACACCCAACTG[T/A]CCTGGTGYCATGAAGAAAGAGGTGAGAYGCACRTATTCTGTTTGCTGTTT
Long Flanking Sequence:
GTAAAGGGTTAGAGTTAGGGTTAAAGCCATAATACTTCACATTGTGGAACATTCCAGCTATTCAGACAAGCAGGAGAGCAGTGTATAATGCTGGTGGTGTTCTAGTAAACTCAAACGGTTTGATTTGTCTGTTTCAGTCTTCATGCCAACCTGACCAAAGGCTTCGGGATAATGGGGCCCAAGGAGTTCTTCCCTTTGCTGGACTTTGCTTACATGCCTAAAAACGCTCTTTCACAGAGGTAAGAGTCACTCAGAGATGTACAGATCTGCAGGATGGTGCTCTAGGCTAGTGTTAAACAGCAGACTAGCACTGTAGGCTAGTGTTTAACAGCAGACGGTGCTCTAGGCTAGTTTTTAGACATTATTTTCTCTGTTTTCAGTCTGCAGGAGCAGTTGTGTCGACTGTACCCACGGATAAAGGTTCTGGCCTTTGGTGCAAAACCTGAATCAACACTGCACACATATTTCCCATCATTCCTGTCACGAGCCACACCCAACTG[T/A]CCTGGTGCCATGAAGAAAGAGGTGAGACGCACATATTCTGTTTGCTGTTTTTATTTCCTGGACTTTGTTGAAATTGATGTGTAACATTAAAATCGATGTATAATCTTAGGGTTGAAGTGATAAAGTGATAGCTCTTGCCTAGTTTTTAACAGCAGACGGCGCTCTAGGCTAGTGTTTGACATCAGATGGCGCTCAAGGCTACATTCAAAGTATTTACAATACTTGTAAAGCATTTACCATAGTTCAAGACTTTACTTAAGCGTTACCAAAATTCAAAGTATAGTTAATGAACTAACAATGAATGACTGTATTTTCATCATCCTTAACAGAGATAAATGAATGTTTTGTTCATGTTAGTAAACACATCACCATCTTAATTTGAAGTCGTAATGTTTATAAATCAGTATGATGCAGCGAGTTTCATATTAATGACATTATCAGTGTTTTACTGCATGACTAGATATTAGTTTATTGATATTGGAGAGGATCTGATGTATGGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5238
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128743 Nonsense 562 675 14 16
Genomic Location (Zv9):
Chromosome 4 (position 473278)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 753134
GRCz11 4 766582
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
KGTGCGTCCGCTGCTGGAGKACGGACAGGAGTATGTGAAGCTGGYGGTGT[T/A]GAAGATYGCACACATGAGCTCAGAGCTGATGCTGTGGATGCAGGAGAACC
Long Flanking Sequence:
AGAAGATATAAACCTGATATTAACATCCAAAGCTTGCTGTTGTCACTTCGGCTTAAATGGATTTTTTTGCCATCATCATTGATCAAGATGCATGAAGTTAAACATGAAAAATTTACATCTTTAGCACATTTTAGAGGACTTTATGCTGTATAACTGCAGGTTTACTATGTTTATTTATACTGTCTAACCGTTACACAACTCTGGTTTTGACTGTAATGAAATAGTGTGCGTTTTACGAAGCCGCTTTGGAATGATAACTAATGTGAAAAGCGGTATAGAAGTGAACTTTATTTGAATTTAAGATGTATATATAATCATGTGCTTGGCTGTTGTGTTTGTCTGTAAACGCTCATCCAGATTTTTTTATTTATTAAAACTATAACATTACCTTTTTTTCCGCAGCTGGCTGTCTGAGAACACGCCATATTATTACTCGAGTGCGGTGACTGCGGTGCGTCCGCTGCTGGAGTACGGACAGGAGTATGTGAAGCTGGCGGTGT[T/A]GAAGATCGCACACATGAGCTCAGAGCTGATGCTGTGGATGCAGGAGAACCTGCCGCTGCTGCTGCACTGGGTGAGAAACACACTCACATGCGCACTCTCATACATACACATATATACACACATCAATGGCGAAAACAGTGAGTGTGTCAATGTAGAGAACAAAAGAGGGAACATGTGTATAAAATATTGTCTACTATTCTGTATGTAAATGCATCTGTGTGATAATTCTGATTACTTTTGGGAATATATATTTTTTCTAATTCTATTTAATTTTTATTTATTAATAATATATTTTATTTTATATATTATATTGATATATATTATATTCAATCATATTATATTAATAAATATTAAATATAAATATATTTAAAATTTTAGTTTTCAGCTTAAAGTGGAATTTTTAATGGATTAAGTAGGCAAGTTATTGGATAACAGTGGTTTGTAATAGTCAAAATTACAGTGGTTAAAATAGTAGTAAAAATAATAATGAATTGTAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40194
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128743 Essential Splice Site 585 675 14 16
ENSDART00000128743 Essential Splice Site 585 675 14 16
Genomic Location (Zv9):
Chromosome 4 (position 473206)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 753062
GRCz11 4 766510
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAGCTGATGCTGTGGATGCAGGAGAACCTGCCGCTGCTGCTGCACTGGG[T/C]GAGAAACACACTCACATGCGCACTCTCATACATACACATATATACACACA
Long Flanking Sequence:
TCATCATTGATCAAGATGCATGAAGTTAAACATGAAAAATTTACATCTTTAGCACATTTTAGAGGACTTTATGCTGTATAACTGCAGGTTTACTATGTTTATTTATACTGTCTAACCGTTACACAACTCTGGTTTTGACTGTAATGAAATAGTGTGCGTTTTACGAAGCCGCTTTGGAATGATAACTAATGTGAAAAGCGGTATAGAAGTGAACTTTATTTGAATTTAAGATGTATATATAATCATGTGCTTGGCTGTTGTGTTTGTCTGTAAACGCTCATCCAGATTTTTTTATTTATTAAAACTATAACATTACCTTTTTTTCCGCAGCTGGCTGTCTGAGAACACGCCATATTATTACTCGAGTGCGGTGACTGCGGTGCGTCCGCTGCTGGAGTACGGACAGGAGTATGTGAAGCTGGCGGTGTTGAAGATCGCACACATGAGCTCAGAGCTGATGCTGTGGATGCAGGAGAACCTGCCGCTGCTGCTGCACTGGG[T/C]GAGAAACACACTCACATGCGCACTCTCATACATACACATATATACACACATCAATGGCGAAAACAGTGAGTGTGTCAATGTAGAGAACAAAAGAGGGAACATGTGTATAAAATATTGTCTACTATTCTGTATGTAAATGCATCTGTGTGATAATTCTGATTACTTTTGGGAATATATATTTTTTCTAATTCTATTTAATTTTTATTTATTAATAATATATTTTATTTTATATATTATATTGATATATATTATATTCAATCATATTATATTAATAAATATTAAATATAAATATATTTAAAATTTTAGTTTTCAGCTTAAAGTGGAATTTTTAATGGATTAAGTAGGCAAGTTATTGGATAACAGTGGTTTGTAATAGTCAAAATTACAGTGGTTAAAATAGTAGTAAAAATAATAATGAATTGTAAAATTGTAAAAAATATTTTATTTAAAATGATTAGTTTTTTTTTTCTTTTGTGGAGATTTTATTTTTGGGGTGTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30843
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128743 Essential Splice Site 585 675 14 16
ENSDART00000128743 Essential Splice Site 585 675 14 16
Genomic Location (Zv9):
Chromosome 4 (position 473206)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 753062
GRCz11 4 766510
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAGCTGATGCTGTGGATGCAGGAGAACCTGCCGCTGCTGCTGCACTGGG[T/C]GAGAAACACACTCACATGCGCACTCTCATACATACACATATATACACACA
Long Flanking Sequence:
TCATCATTGATCAAGATGCATGAAGTTAAACATGAAAAATTTACATCTTTAGCACATTTTAGAGGACTTTATGCTGTATAACTGCAGGTTTACTATGTTTATTTATACTGTCTAACCGTTACACAACTCTGGTTTTGACTGTAATGAAATAGTGTGCGTTTTACGAAGCCGCTTTGGAATGATAACTAATGTGAAAAGCGGTATAGAAGTGAACTTTATTTGAATTTAAGATGTATATATAATCATGTGCTTGGCTGTTGTGTTTGTCTGTAAACGCTCATCCAGATTTTTTTATTTATTAAAACTATAACATTACCTTTTTTTCCGCAGCTGGCTGTCTGAGAACACGCCATATTATTACTCGAGTGCGGTGACTGCGGTGCGTCCGCTGCTGGAGTACGGACAGGAGTATGTGAAGCTGGCGGTGTTGAAGATCGCACACATGAGCTCAGAGCTGATGCTGTGGATGCAGGAGAACCTGCCGCTGCTGCTGCACTGGG[T/C]GAGAAACACACTCACATGCGCACTCTCATACATACACATATATACACACATCAATGGCGAAAACAGTGAGTGTGTCAATGTAGAGAACAAAAGAGGGAACATGTGTATAAAATATTGTCTACTATTCTGTATGTAAATGCATCTGTGTGATAATTCTGATTACTTTTGGGAATATATATTTTTTCTAATTCTATTTAATTTTTATTTATTAATAATATATTTTATTTTATATATTATATTGATATATATTATATTCAATCATATTATATTAATAAATATTAAATATAAATATATTTAAAATTTTAGTTTTCAGCTTAAAGTGGAATTTTTAATGGATTAAGTAGGCAAGTTATTGGATAACAGTGGTTTGTAATAGTCAAAATTACAGTGGTTAAAATAGTAGTAAAAATAATAATGAATTGTAAAATTGTAAAAAATATTTTATTTAAAATGATTAGTTTTTTTTTTCTTTTGTGGAGATTTTATTTTTGGGGTGTTTT
Associated Phenotype:
Not determined