Busch Lab

ZMP

ENSDARG00000016923

Ensembl ID:
ENSDARG00000016923
Human Orthologue:
RIC8A
Human Description:
resistance to inhibitors of cholinesterase 8 homolog A (C. elegans) [Source:HGNC Symbol;Acc:29550]
Mouse Orthologue:
Ric8
Mouse Description:
resistance to inhibitors of cholinesterase 8 homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:21

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa10218 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10218
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002233 Nonsense 350 543 9 12
Genomic Location (Zv9):
Chromosome 12 (position 5405523)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4538741
GRCz11 12 4573753
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGGTGAAGGAGAGACTGACCCCAGTGCTGAACYTGCTGGCCGAATGCTCC[A/T]GAGCTCACAGAGACACCAGACTCTACCTCAGACAACAGGCATGSCCACCG
Associated Phenotype:
Not determined