Busch Lab

ZMP

smarce1

Ensembl ID:
ENSDARG00000016871
ZFIN ID:
ZDB-GENE-030131-967
Description:
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1 [
Human Orthologue:
SMARCE1
Human Description:
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1 [S
Mouse Orthologue:
Smarce1
Mouse Description:
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1 Ge

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa33229 Nonsense Mutation detected in F1 DNA Not yet available
sa12524 Nonsense Available for shipment Available now
sa12565 Nonsense Available for shipment Available now
sa20071 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33229
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011319 Nonsense 83 424 5 10
ENSDART00000121981 Nonsense 79 420 6 11
Genomic Location (Zv9):
Chromosome 3 (position 35075376)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 34860572
GRCz11 3 34990080
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGTGTTCTCTGTCAGCTCTGAGCTGACTTTTGTATCTTTTGAAGGTTTG[G/A]GACCAAGTTAAAGCCTCTAATCCTGACCTGAAGCTATGGGAGATTGGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12524
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011319 Nonsense 161 424 6 10
ENSDART00000121981 Nonsense 157 420 7 11
ENSDART00000011319 Nonsense 161 424 6 10
ENSDART00000121981 Nonsense 157 420 7 11
Genomic Location (Zv9):
Chromosome 3 (position 35076210)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 34861406
GRCz11 3 34990914
KASP Assay ID:
2259-3756.1 (used for ordering genotyping assays)
KASP Sequence:
ACGTTAATGCAAAGAACCGCGCAGAAGCAGCTCYAGAGGAAGAAAGCCGG[C/T]AGAGACAGTCACGTTTAGACAAAGGGGAGCCCTACATGAGCATCCAACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12565
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011319 Nonsense 161 424 6 10
ENSDART00000121981 Nonsense 157 420 7 11
ENSDART00000011319 Nonsense 161 424 6 10
ENSDART00000121981 Nonsense 157 420 7 11
Genomic Location (Zv9):
Chromosome 3 (position 35076210)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 34861406
GRCz11 3 34990914
KASP Assay ID:
2259-3756.1 (used for ordering genotyping assays)
KASP Sequence:
ACGTTAATGCAAAGAACCGCGCAGAAGCAGCTCYAGAGGAAGAAAGCCGG[C/T]AGAGACAGTCACGTTTAGACAAAGGGGAGCCCTACATGAGCATCCAACCC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa18757
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011319 Nonsense 315 424 9 10
ENSDART00000121981 Nonsense 311 420 10 11
ENSDART00000011319 Nonsense 315 424 9 10
ENSDART00000121981 Nonsense 311 420 10 11
Genomic Location (Zv9):
Chromosome 3 (position 35077617)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 34862813
GRCz11 3 34992321
KASP Assay ID:
2259-3758.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCGCCGGAGGGCGGAGGAGAGAGAGCGGGAAGCAGCGGAGCAGGTGGAG[C/T]GAGCCGCTCAAGAAGAGCAACAGCCCGCCAGCGCCCAGGCCAATGCCAAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa18758
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011319 Nonsense 315 424 9 10
ENSDART00000121981 Nonsense 311 420 10 11
ENSDART00000011319 Nonsense 315 424 9 10
ENSDART00000121981 Nonsense 311 420 10 11
Genomic Location (Zv9):
Chromosome 3 (position 35077617)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 34862813
GRCz11 3 34992321
KASP Assay ID:
2259-3758.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCGCCGGAGGGCGGAGGAGAGAGAGCGGGAAGCAGCGGAGCAGGTGGAG[C/T]GAGCCGCTCAAGAAGAGCAACAGCCCGCCAGCGCCCAGGCCAATGCCAAC
Associated Phenotype:
This allele has been associated with this phenotype by genetic linkage analysis and may not be causal.
See FAQs for more info.
Stage Entity Quality Tag
Hatching:Long-pec
ZFS:0000033
pericardium
ZFA:0000054
edematous
PATO:0001450
abnormal
PATO:0000460

Mutation Details

Allele Name:
sa20071
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011319 Nonsense 424 424 10 10
ENSDART00000121981 Nonsense 420 420 11 11
Genomic Location (Zv9):
Chromosome 3 (position 35079579)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 34864775
GRCz11 3 34994283
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCAGACCGCATCAGACAACACCCCTGAGGAGCGCCTGCCCACCCAGCCA[C/T]AATAACACATCCACACACTCTCACCTCGCTCTGCGTAGAGTCATGTGTCC
Associated Phenotype:
Not determined