Busch Lab

ZMP

si:rp71-23d18.1

Ensembl ID:
ENSDARG00000016825
ZFIN IDs:
ZDB-GENE-001201-5, ZDB-GENE-001201-5, ZDB-GENE-001201-5, ZDB-GENE-091118-131
Description:
vitellogenin 6 [Source:RefSeq peptide;Acc:NP_001116082]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa43855 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa24181 Nonsense Available for shipment Available now
sa43854 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa43855
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078231 None None 251 None 11
ENSDART00000078238 None None 355 None 8
ENSDART00000143443 Essential Splice Site 160 1368 4 28

The following transcripts of ENSDARG00000016825 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 25289734)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 24789640
GRCz11 22 24817264
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCTTCAGCTCAACCTCAAGAAGACGCAGAACATCTACGAGCTGCAAGAG[G/A]TGAGGAAATCCCCTTAGGACAATTCTGCGGTATTTTGAGTTCTGCAATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24181
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078231 None None 251 None 11
ENSDART00000078238 None None 355 None 8
ENSDART00000143443 Nonsense 288 1368 7 28

The following transcripts of ENSDARG00000016825 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 25289103)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 24789009
GRCz11 22 24816633
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGATTGAGAAGACCCCTGTTGTTCCAATCAAAGCTGATTACATGCCCCGT[G/T]GATCCCTGCAGTACGAGTTTGCATCTGAGATTCTTCAGACCCCCATTCAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5005
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078231 None None 251 None 11
ENSDART00000078238 None None 355 None 8
ENSDART00000143443 Essential Splice Site 643 1368 13 28
ENSDART00000078231 None None 251 None 11
ENSDART00000078238 None None 355 None 8
ENSDART00000143443 Essential Splice Site 643 1368 13 28

The following transcripts of ENSDARG00000016825 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 25287511)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 24787417
GRCz11 22 24815041
KASP Assay ID:
2261-6895.1 (used for ordering genotyping assays)
KASP Sequence:
AGACTTAACTACCGTTATAGCAGAGCTTTTCAGATGGACTATTATTATAG[T/A]AAGACTTTCGAATTTCTTAAAAAAAGCTAAGAAATAGTATTTGATGATTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19298
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078231 None None 251 None 11
ENSDART00000078238 None None 355 None 8
ENSDART00000143443 Essential Splice Site 643 1368 13 28
ENSDART00000078231 None None 251 None 11
ENSDART00000078238 None None 355 None 8
ENSDART00000143443 Essential Splice Site 643 1368 13 28

The following transcripts of ENSDARG00000016825 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 25287511)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 24787417
GRCz11 22 24815041
KASP Assay ID:
2261-6895.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGACTTAACTACCGTTATAGCAGAGCTTTTCAGATGGACTATTATTATAG[T/A]AAGACTTTCGAATTTCTTAAAAAAAGCTAAGAAATAGTATTTGATGATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43854
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078231 None None 251 None 11
ENSDART00000078238 None None 355 None 8
ENSDART00000143443 Nonsense 1009 1368 21 28

The following transcripts of ENSDARG00000016825 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 25285667)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 24785573
GRCz11 22 24813197
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCACAATGCTGCTTTTATCAGAAATTCTACGCTGTTCTACATAATTGGA[C/T]AGCACTCAGCCCATGTTGCAGTGGCAAGAGGTGAGAGATGATAGAGAGAC
Associated Phenotype:
Not determined