Busch Lab

ZMP

huwe1

Ensembl ID:
ENSDARG00000016782
ZFIN ID:
ZDB-GENE-081104-387
Human Orthologue:
HUWE1
Human Description:
HECT, UBA and WWE domain containing 1 [Source:HGNC Symbol;Acc:30892]
Mouse Orthologue:
Huwe1
Mouse Description:
HECT, UBA and WWE domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1926884]

Alleles

There are 16 alleles of this gene:

Allele Name Consequence Status Availability
sa37738 Splice Site, Nonsense Mutation detected in F1 DNA Not yet available
sa618 Essential Splice Site Available for shipment Available now
sa37739 Nonsense Available for shipment Available now
sa15608 Essential Splice Site Available for shipment Available now
sa24357 Nonsense Available for shipment Available now
sa44001 Splice Site, Nonsense Mutation detected in F1 DNA Not yet available
sa17915 Essential Splice Site Available for shipment Available now
sa37740 Nonsense Mutation detected in F1 DNA Not yet available
sa39413 Nonsense Mutation detected in F1 DNA Not yet available
sa37741 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa44002 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa24358 Essential Splice Site Available for shipment Available now
sa30743 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa37738
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006657 Splice Site, Nonsense 49 4569 3 80
ENSDART00000146990 Splice Site, Nonsense 53 4474 3 79
Genomic Location (Zv9):
Chromosome 23 (position 28737404)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 28567971
GRCz11 23 28494512
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAATATGCATGTTCAGATCTTCATTGATGACCTGTTTCTCTTCCCAGTG[C/A]GAGTTGTATCATTGGGTGGACTTGCTGGACCGCTTTGATGGCATCCTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa618
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006657 Essential Splice Site 231 4569 7 80
ENSDART00000146990 Essential Splice Site 235 4474 7 79
Genomic Location (Zv9):
Chromosome 23 (position 28740634)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 28571201
GRCz11 23 28497742
KASP Assay ID:
554-0528.1 (used for ordering genotyping assays)
KASP Sequence:
GTCAAGCAGTAATACGCTACACTACATTCATATCGAACAACTTGATAAGG[T/C]GAGTTTCTGGGGTTTACATTTGCTGTCCTTGTGGAACAGTTAATGGAAGT
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa37739
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006657 Nonsense 423 4569 12 80
ENSDART00000146990 Nonsense 426 4474 12 79
Genomic Location (Zv9):
Chromosome 23 (position 28743691)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 28574258
GRCz11 23 28500799
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTAACCTATGCCACTTTCACATCAGGTGATCAAGTTCCTAGGGGACGAG[C/T]AGGACCAGATTACCTTTGTGACGCGGGCAGTGAGAGTTGTGGATCTCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15608
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006657 Essential Splice Site 533 4569 14 80
ENSDART00000146990 Essential Splice Site 536 4474 14 79
Genomic Location (Zv9):
Chromosome 23 (position 28746954)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 28577521
GRCz11 23 28504062
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGACCGATTCGCGAGCACARAGCAATGCATCCAGCACCCCAAGAGCAGG[T/C]AAAAAYACTNCCAARTACTCTAACTCACAWGTCAGTGGGTGTGYAGTTTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24357
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006657 Nonsense 957 4569 24 80
ENSDART00000146990 Nonsense 960 4474 24 79
Genomic Location (Zv9):
Chromosome 23 (position 28753635)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 28584202
GRCz11 23 28510743
KASP Assay ID:
2261-7913.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCATCTCTTGCTCCTCCTTTCAGAGCGAGATTCGTGCTATCTCTGTGAAT[C/T]AATGGGGATCTCAACTGGGTCTTAGTGTTTTGAACAAACTGAGTCAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44001
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006657 Splice Site, Nonsense 1396 4569 30 80
ENSDART00000146990 None None 4474 None 79
Genomic Location (Zv9):
Chromosome 23 (position 28757769)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 28588336
GRCz11 23 28514877
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTCTACTACAGCACGCAGAGAGCCACAGGTCAACCAAGCTCAGCTCACA[C/T]AGGTATGTCACTTCCTGTTATTAGATATTCCTGCTGCATTTAAATTTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17915
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006657 Essential Splice Site 1437 4569 31 80
ENSDART00000146990 Essential Splice Site 1404 4474 31 79
Genomic Location (Zv9):
Chromosome 23 (position 28758134)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 28588701
GRCz11 23 28515242
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGAGTACCTGCTCACACACCCTCCACCACTGCTCAGCGCGGCTGTCAGAG[T/G]AAGACCCTAAYCAACACAGACAAAACCCTCWGTCTTTCTCCCATACACTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29951
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006657 Nonsense 1702 4569 37 80
ENSDART00000146990 Nonsense 1669 4474 37 79
Genomic Location (Zv9):
Chromosome 23 (position 28764533)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 28595100
GRCz11 23 28521641
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGGAATAACTGGCGCTGGTTTGATGACCGTTCAGGCCGCTGGTGCAGCTA[C/A]AGTGCAAGTAACAACAGCACTATTGACTCTGCATGGAGGGCAGGAGAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37740
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006657 Nonsense 2745 4569 55 80
ENSDART00000146990 None None 4474 None 79
Genomic Location (Zv9):
Chromosome 23 (position 28776635)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 28607202
GRCz11 23 28533743
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGATGGACAGATGAGTGTAAAGTGCTGGATGCTGAGAGCATGCATGACTG[T/A]GTGGCAGGTGAGATCATCTCAGAACGAATATATGATAGCATCTGTTGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39413
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006657 Nonsense 3412 4569 63 80
ENSDART00000146990 Nonsense 3336 4474 62 79
Genomic Location (Zv9):
Chromosome 23 (position 28784672)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 28615239
GRCz11 23 28541780
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATCAATGGACGCAGCTCTTGGATGCAGAACCAACATCTTTCAGATCCAG[C/T]GAGTATCAGGCAGGAAACACGCAGAGAGGCATTCAGCAGGAGGGAGTGTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8021
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006657 Nonsense 3942 4569 69 80
ENSDART00000146990 Nonsense 3866 4474 68 79
Genomic Location (Zv9):
Chromosome 23 (position 28795030)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 28625597
GRCz11 23 28552138
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACGCCATCATTCAGATGGTGAGAGAGGGACAGAGGGCACGCCGTCTACAG[C/T]AGGCCCCCCCACCCTCTTCATCTGCATCCTCTTCCNNNGCTGCTGCTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37741
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006657 Essential Splice Site 4023 4569 70 80
ENSDART00000146990 Essential Splice Site 3947 4474 69 79
Genomic Location (Zv9):
Chromosome 23 (position 28797768)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 28628335
GRCz11 23 28554876
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGGATGTGGATCAGCCCTCTCCTTTGGAACAGGACCAGCCAACATTAGG[T/C]GAGTGTCTGGGAATATAGGACAACCTAACAATAGGAACGTCACTGGCTTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5058
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006657 Essential Splice Site 4372 4569 76 80
ENSDART00000146990 Essential Splice Site 4296 4474 75 79
Genomic Location (Zv9):
Chromosome 23 (position 28804751)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 28635318
GRCz11 23 28561859
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGAGAACGATGTGTCGACTCTGGGCTAYGAGCTGACATTCAGCACAGAGG[T/C]ATAGGCTGCATTTTCATACCAATTACACCTWCTTATTGTGTTATTCTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44002
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006657 Essential Splice Site 4472 4569 78 80
ENSDART00000146990 Essential Splice Site 4396 4474 77 79
Genomic Location (Zv9):
Chromosome 23 (position 28807192)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 28637759
GRCz11 23 28564300
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCTCAAGGCCAATACTGAATACCATAAATATCAGTCCAGTTCTATTCAG[G/A]TGTGTACACACACAATAGGATGACATGAAATAAAATATTTGATTGTTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24358
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006657 Essential Splice Site 4472 4569 78 80
ENSDART00000146990 Essential Splice Site 4396 4474 77 79
Genomic Location (Zv9):
Chromosome 23 (position 28807193)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 28637760
GRCz11 23 28564301
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTCAAGGCCAATACTGAATACCATAAATATCAGTCCAGTTCTATTCAGG[T/C]GTGTACACACACAATAGGATGACATGAAATAAAATATTTGATTGTTTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30743
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006657 Essential Splice Site 4536 4569 79 80
ENSDART00000146990 Essential Splice Site 4460 4474 None 79
Genomic Location (Zv9):
Chromosome 23 (position 28808902)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 28639469
GRCz11 23 28566010
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCCACCGAGATGACCGCTCCACTGACCGCCTGCCCTCTGCGCACACTTG[G/T]TAAATGCTCATATATTAATGATGTGCCTTTTAAAACAAACAATTCAAGTG
Associated Phenotype:
Not determined