Busch Lab

ZMP

sc:d0316

Ensembl ID:
ENSDARG00000016739
ZFIN ID:
ZDB-GENE-080327-5
Description:
cDNA, clone cssl:d0316 [Source:UniProtKB/TrEMBL;Acc:A8BAU2]
Human Orthologue:
LRRC4C
Human Description:
leucine rich repeat containing 4C [Source:HGNC Symbol;Acc:29317]
Mouse Orthologue:
Lrrc4c
Mouse Description:
leucine rich repeat containing 4C Gene [Source:MGI Symbol;Acc:MGI:2442636]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa41005 Nonsense Mutation detected in F1 DNA Not yet available
sa238 Nonsense Confirmed mutation in F2 line Not yet available
sa38639 Nonsense Mutation detected in F1 DNA Not yet available
sa34176 Nonsense Mutation detected in F1 DNA Not yet available
sa21060 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41005
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021605 Nonsense 23 631 1 1
Genomic Location (Zv9):
Chromosome 7 (position 51566295)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 49836531
GRCz11 7 50109307
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTTTCCATCAGCGCCAGATGTTGAGAGGTCCTAGATGGAAAGGGGCTTG[G/A]TTTGACCCCTTGTTTCTCCTGCTTTTAGCCCTGCAGTTGCTTGTTGTCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa238
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021605 Nonsense 155 631 1 1
Genomic Location (Zv9):
Chromosome 7 (position 51566691)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 49836927
GRCz11 7 50109703
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCATCCCCAATGGCGCCTTTGAGTACCTATCTAAACTAAAAGAGCTGTG[G/A]CTTAGGAATAACCCTATCGAGAGCATACCGTCTGATGCCTTCAGTCGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38639
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021605 Nonsense 236 631 1 1
Genomic Location (Zv9):
Chromosome 7 (position 51566932)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 49837168
GRCz11 7 50109944
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGATTCGCCTGGATGAGCTGGAGATGTCCGGGAATCAACTCACTGTCATC[C/T]AGCCCAGCTCTTTTAAGGGTCTTGTTCATCTCCAGAAGCTGTGGATGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34176
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021605 Nonsense 616 631 1 1
Genomic Location (Zv9):
Chromosome 7 (position 51568073)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 49838309
GRCz11 7 50111085
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAACCACGTGTCTGCTCTCAGCTCGCTGCATAGTTCAGTGCATGAACCTT[T/A]ACTAATCCAAGCCAGCTCAAAGGATAACGTACAGGAGACGCAAATTTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21060
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021605 Nonsense 622 631 1 1
Genomic Location (Zv9):
Chromosome 7 (position 51568091)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 49838327
GRCz11 7 50111103
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGCTCGCTGCATAGTTCAGTGCATGAACCTTTACTAATCCAAGCCAGCT[C/A]AAAGGATAACGTACAGGAGACGCAAATTTGACCACGTTGGGTGAAACGAA
Associated Phenotype:
Not determined