Busch Lab

ZMP

bcan

Ensembl ID:
ENSDARG00000016736
ZFIN ID:
ZDB-GENE-030131-6045
Description:
brevican core protein [Source:RefSeq peptide;Acc:NP_001077282]
Human Orthologue:
BCAN
Human Description:
brevican [Source:HGNC Symbol;Acc:23059]
Mouse Orthologue:
Bcan
Mouse Description:
brevican Gene [Source:MGI Symbol;Acc:MGI:1096385]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa36168 Nonsense Mutation detected in F1 DNA Not yet available
sa1944 Essential Splice Site, Splice Site Available for shipment Available now
sa10253 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36168
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047499 Nonsense 116 1300 3 14
ENSDART00000130700 None None 191 None 5
Genomic Location (Zv9):
Chromosome 16 (position 31558741)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 29395930
GRCz11 16 29330553
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGGGTTAAGGTGAGTGAGGCTTATAAAGGCAGAGCGTCGCTGCTCAATTA[C/A]GCTACCTCTTCAGCTGATCTCACCCTCAGACTGGAGGGATTGATTCACAA
Long Flanking Sequence:
TGCGAGAACTGTACTTTTAAATGGTTCCCAAATTGTTCCTTTTATTGCATTGCTGCAAAAATAACCTTTATTTTTAATAGGCAAACATTGACACAAGGTATTTTACATAATTTTATTGCACTCTGTCTCTTCAGGAATGCCTGCACACTATAACTAAAATCAAAGCTTTAAACACTGCTGATGAAATACCATTAGCTTCATTACTTTCAGTTCATTAATATCTCCATCCTTTATGTCTTAACCTCAGATGATTCTTCAGCCTTAAAAGTGGCCATTCCTGCCAGCTCACCAGTGTCTGCTGTTTTGGGTGGCTCTTTGACGCTGCCCTGCCTGGTGAGTCTTCCCCGTACGCCATCTTTGGGTCGACATGCAGTATTGACGCAGCCACGGGTCAAATGGAGCTTTCTTTCATCAGACAGAGAGACAGAGATTCTGGTGGCCCGTGGTGAGCGGGTTAAGGTGAGTGAGGCTTATAAAGGCAGAGCGTCGCTGCTCAATTA[C/A]GCTACCTCTTCAGCTGATCTCACCCTCAGACTGGAGGGATTGATTCACAACGACACAGGTTTCTACCGGTGCGAGGTCCAGCATGGCCTGGAGGACTCACATGACCAGGCTCAAGTCAAAGTTAAGGGTGAGAATTATCTGAAAAACACTCTCTGCCATAGACCACTGTCAGAATGGAAATCAACTGGGGTTTGAATCCAAGTGGTACAGAAGATTTGGTTGTAAATTCCAGCTAAATTAAATTATATTAAACAGTTAATAATAATTAGATTAAAAAGAAAATAATTAAGTTAAAAAGTAATCTAAATAATTACTGTTACAAATATTAGGTCACAATTTATTTTGATAGTCCGTTTGATGAATATAAGTTACAGTGCATCTACATGCCAACTAATTCTCATTAGAGTTGATTTATTAGTAGACTGTTGGAGTTTGGGTCAAGTAAGTTGACATGTGCTTGCAAAGTTTCTTATTGTCAGTTAAATGTCGATTTAGCAGCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4666
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047499 Nonsense 254 1300 5 14
ENSDART00000130700 Nonsense 96 191 2 5
Genomic Location (Zv9):
Chromosome 16 (position 31553396)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 29390585
GRCz11 16 29325208
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGTAACTAYGGCACGATGGAGAACGAYGAACTCTATGACGTATATTGCTA[T/A]GTGGAGAACATTCATGGTAAAYAATTAGCTGCTAATNNNGTTACGCTTGAAAA
Long Flanking Sequence:
GAAAAAGCTTCTAAAAAAGCCTCAAAAGTCCATTATGTTGTCCAACAGCTGCAATATTTGTCAAACTGTGTAGAGAGTTGTTTATCCAGGTGCTGATATTAGTTAAATATCTCACGACTATCAGCCAATCAGATTCGAGGACGCGACTGAATTGTTGTATAAATACATATGTACGCATGTGTAAAACTAATAGGGCTTAATAAAGACATGGCTATGTTAATTTGTAGATCATCTAGCAACATTTAGTAACTTTTTATGTAGGAATTCGCTACTATTTATTAAAGCCATTTGGCAACATTATGTACATCAACATTAGCAACTGATTTGTAACAAAATATGTTTTGAAGCTTTTGTTGTTAATAAAAAGATATTATGTTATGGAGTTTTAGATACCCGATCCAGATGCCTCGGGAAGGGTGTTTTGGAGATATGGATGGATTACCAGGCGTTCGTAACTACGGCACGATGGAGAACGATGAACTCTATGACGTATATTGCTA[T/A]GTGGAGAACATTCATGGTAAACAATTAGCTGCTAATGTTACGCTTGAAAAACAGTACTCTTGACTGTACGCCAAAACTAGCATTTCATATTTGTATTAGATTATTTTCAGAGAATGCAGGGTGCAGTGTGATTGTCAGTTTTTCCAAAGCAAGAAAGGTTTGTTCATTTATTGATGTGACTGTTTTTAGGGGAGGTTTTTCATGGCTCAACCCCGCAGCGCTTCAGCTTGTCAGAGGCAAAGGCGTACTGTGAGCAGCAGGACGCTCAGCTCGCTACCACAGGTCAGCTGTACGCTGCCTGGAATGATGGTCTGAACCACTGCAGTCCTGGCTGGCTCGCTGACGGAAGCGTTCGCTACCCCATCGTGACCCCCCGTGAACGCTGTGGGGGCTCTGAACCTGGCGTCAAGACCGTCTATCGGTTTAGCAATCAAACAGGATTCCCTGAACCAAACACTCGCCATGATGCTTACTGCTTCAAAGGTATTTACAGATTTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1944
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Essential Splice Site, Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047499 Splice Site None 1300 None 14
ENSDART00000130700 Essential Splice Site 103 191 2 5
Genomic Location (Zv9):
Chromosome 16 (position 31553374)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 29390563
GRCz11 16 29325186
KASP Assay ID:
554-1932.1 (used for ordering genotyping assays)
KASP Sequence:
ACGAYGAACTCTATGACGTATATTGCTATGTGGAGAACATTCATGGTAAA[C/T]AATTAGCTGCTAATNNNGTTACGCTTGAAAAACAGTACTCTTGACTGTACGCC
Long Flanking Sequence:
CAAAAGTCCATTATGTTGTCCAACAGCTGCAATATTTGTCAAACTGTGTAGAGAGTTGTTTATCCAGGTGCTGATATTAGTTAAATATCTCACGACTATCAGCCAATCAGATTCGAGGACGCGACTGAATTGTTGTATAAATACATATGTACGCATGTGTAAAACTAATAGGGCTTAATAAAGACATGGCTATGTTAATTTGTAGATCATCTAGCAACATTTAGTAACTTTTTATGTAGGAATTCGCTACTATTTATTAAAGCCATTTGGCAACATTATGTACATCAACATTAGCAACTGATTTGTAACAAAATATGTTTTGAAGCTTTTGTTGTTAATAAAAAGATATTATGTTATGGAGTTTTAGATACCCGATCCAGATGCCTCGGGAAGGGTGTTTTGGAGATATGGATGGATTACCAGGCGTTCGTAACTACGGCACGATGGAGAACGATGAACTCTATGACGTATATTGCTATGTGGAGAACATTCATGGTAAA[C/T]AATTAGCTGCTAATGTTACGCTTGAAAAACAGTACTCTTGACTGTACGCCAAAACTAGCATTTCATATTTGTATTAGATTATTTTCAGAGAATGCAGGGTGCAGTGTGATTGTCAGTTTTTCCAAAGCAAGAAAGGTTTGTTCATTTATTGATGTGACTGTTTTTAGGGGAGGTTTTTCATGGCTCAACCCCGCAGCGCTTCAGCTTGTCAGAGGCAAAGGCGTACTGTGAGCAGCAGGACGCTCAGCTCGCTACCACAGGTCAGCTGTACGCTGCCTGGAATGATGGTCTGAACCACTGCAGTCCTGGCTGGCTCGCTGACGGAAGCGTTCGCTACCCCATCGTGACCCCCCGTGAACGCTGTGGGGGCTCTGAACCTGGCGTCAAGACCGTCTATCGGTTTAGCAATCAAACAGGATTCCCTGAACCAAACACTCGCCATGATGCTTACTGCTTCAAAGGTATTTACAGATTTGAGTTTTATCTGCAAATGTATAAAC
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa10253
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047499 None None 1300 None 14
ENSDART00000130700 Nonsense 107 191 3 5
Genomic Location (Zv9):
Chromosome 16 (position 31553287)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 29390476
GRCz11 16 29325099
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTWGACTGTACGCCAAAACTAGCATTTCAWATTTGWATTAGATTATTTWC[A/T]GAGAATGCAGGGTGCAGTNWGATTGTCAGTTTTTCCAAAGCAAGAAAGGT
Long Flanking Sequence:
TCTCACGACTATCAGCCAATCAGATTCGAGGACGCGACTGAATTGTTGTATAAATACATATGTACGCATGTGTAAAACTAATAGGGCTTAATAAAGACATGGCTATGTTAATTTGTAGATCATCTAGCAACATTTAGTAACTTTTTATGTAGGAATTCGCTACTATTTATTAAAGCCATTTGGCAACATTATGTACATCAACATTAGCAACTGATTTGTAACAAAATATGTTTTGAAGCTTTTGTTGTTAATAAAAAGATATTATGTTATGGAGTTTTAGATACCCGATCCAGATGCCTCGGGAAGGGTGTTTTGGAGATATGGATGGATTACCAGGCGTTCGTAACTACGGCACGATGGAGAACGATGAACTCTATGACGTATATTGCTATGTGGAGAACATTCATGGTAAACAATTAGCTGCTAATGTTACGCTTGAAAAACAGTACTCTTGACTGTACGCCAAAACTAGCATTTCATATTTGTATTAGATTATTTTC[A/T]GAGAATGCAGGGTGCAGTGTGATTGTCAGTTTTTCCAAAGCAAGAAAGGTTTGTTCATTTATTGATGTGACTGTTTTTAGGGGAGGTTTTTCATGGCTCAACCCCGCAGCGCTTCAGCTTGTCAGAGGCAAAGGCGTACTGTGAGCAGCAGGACGCTCAGCTCGCTACCACAGGTCAGCTGTACGCTGCCTGGAATGATGGTCTGAACCACTGCAGTCCTGGCTGGCTCGCTGACGGAAGCGTTCGCTACCCCATCGTGACCCCCCGTGAACGCTGTGGGGGCTCTGAACCTGGCGTCAAGACCGTCTATCGGTTTAGCAATCAAACAGGATTCCCTGAACCAAACACTCGCCATGATGCTTACTGCTTCAAAGGTATTTACAGATTTGAGTTTTATCTGCAAATGTATAAACTGTATAACACAGGATTCAAACTGTGGGGTTCAAAGGGTGTGGTGCTAGGTCTACAATAAATTAAAATAAAGCTGTATTTTATACATA
Associated Phenotype:
Not determined