Busch Lab

ZMP

sdha

Ensembl ID:
ENSDARG00000016721
ZFIN ID:
ZDB-GENE-040426-874
Description:
Succinate dehydrogenase [ubiquinone] flavoprotein subunit, mitochondrial [Source:UniProtKB/Swiss-Pro
Human Orthologue:
SDHA
Human Description:
succinate dehydrogenase complex, subunit A, flavoprotein (Fp) [Source:HGNC Symbol;Acc:10680]
Mouse Orthologue:
Sdha
Mouse Description:
succinate dehydrogenase complex, subunit A, flavoprotein (Fp) Gene [Source:MGI Symbol;Acc:MGI:191419

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa36776 Nonsense Available for shipment Available now
sa23438 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa36776
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015559 Nonsense 52 661 3 15
ENSDART00000081754 Nonsense 52 661 3 17

The following transcripts of ENSDARG00000016721 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 7912852)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 7371391
GRCz11 19 7290316
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGTTTGATCAGTGTTTTTGGTATTTGTCTTGACAGGTCTCCAATCAGTA[T/A]CCAGTAGTAGATCATGAGTTTGATGCAGTCGTGGTTGGAGCTGGCGGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23438
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015559 Essential Splice Site 475 661 None 15
ENSDART00000081754 Essential Splice Site 475 661 None 17

The following transcripts of ENSDARG00000016721 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 7905909)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 7364448
GRCz11 19 7283373
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGTTTGGACGTGCCTGTGCCCTGACCATTGCTGAGATTGACACTCCAGG[T/C]ACATTCATAACACTCAGAAATGATAAAGGAAGTGGATAGTAGGCATGGGA
Associated Phenotype:
Not determined