Busch Lab

ZMP

acadvl

Ensembl ID:
ENSDARG00000016687
ZFIN ID:
ZDB-GENE-030131-899
Description:
very long-chain specific acyl-CoA dehydrogenase, mitochondrial [Source:RefSeq peptide;Acc:NP_997776
Human Orthologue:
ACADVL
Human Description:
acyl-CoA dehydrogenase, very long chain [Source:HGNC Symbol;Acc:92]
Mouse Orthologue:
Acadvl
Mouse Description:
acyl-Coenzyme A dehydrogenase, very long chain Gene [Source:MGI Symbol;Acc:MGI:895149]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa20905 Nonsense Available for shipment Available now
sa34039 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa2360 Essential Splice Site F2 line generated Not yet available

Mutation Details

Allele Name:
sa20905
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023089 Nonsense 304 659 11 21
ENSDART00000131019 Nonsense 304 659 10 20
ENSDART00000143030 None None 179 None 7
Genomic Location (Zv9):
Chromosome 7 (position 21468478)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 20058914
GRCz11 7 20310882
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCCATATTCACCTTAATTAATACTCTCTTTCAGTGGTCCTCCTGAGAAA[A/T]AGATGGGCATTAAAGCGTCCAACACCGCAGAAGTGTATTTTGAGAATGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34039
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023089 Essential Splice Site 516 659 16 21
ENSDART00000131019 Essential Splice Site 516 659 15 20
ENSDART00000143030 None None 179 None 7
Genomic Location (Zv9):
Chromosome 7 (position 21483642)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 20074078
GRCz11 7 20326046
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGGTAATGCTGGGATGTTGGCGGGTGAAATCACAAAGCGAGCCAAGAGG[T/G]TAGACCTTCATATCTCTCATAACACTTCTGCAAGACATTAGTTTGGTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2360
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023089 Essential Splice Site 565 659 19 21
ENSDART00000131019 Essential Splice Site 565 659 18 20
ENSDART00000143030 None None 179 None 7
Genomic Location (Zv9):
Chromosome 7 (position 21485961)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 20076397
GRCz11 7 20328365
KASP Assay ID:
554-2839.1 (used for ordering genotyping assays)
KASP Sequence:
TTGCACCTTTGCCTGTGGTAATTGTGTGATTTCTGTATGTTTTTCTCTTT[A/C]GATGAACAATTTGTTCTGAAGCGAGTTGCTGACTGTGCCATTGATCTGTA
Associated Phenotype:
Not determined