Busch Lab

ZMP

si:ch211-283f6.8

Ensembl ID:
ENSDARG00000016651
ZFIN ID:
ZDB-GENE-030219-199
Description:
Zgc:100799 [Source:UniProtKB/TrEMBL;Acc:Q6DGE8]
Human Orthologue:
ZFP106
Human Description:
zinc finger protein 106 homolog (mouse) [Source:HGNC Symbol;Acc:23240]
Mouse Orthologue:
Zfp106
Mouse Description:
zinc finger protein 106 Gene [Source:MGI Symbol;Acc:MGI:1270153]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa14610 Nonsense Available for shipment Available now
sa28922 Nonsense Mutation detected in F1 DNA Not yet available
sa36514 Nonsense Mutation detected in F1 DNA Not yet available
sa36513 Nonsense Mutation detected in F1 DNA Not yet available
sa36512 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa14610
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112075 Nonsense 28 1636 2 21
ENSDART00000132969 None None 382 None 11

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 45537449)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 45386681
GRCz11 17 45369933
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGMCRTGTCCTATTTTTTTAGGAGAYGGAAGAGCACATGAGAAGTATGT[T/A]GCACCACCGAGAGCTRGAGAATCTGAAAGGCCGGTAAGAGGAAWTGAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28922
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112075 Nonsense 127 1636 4 21
ENSDART00000132969 None None 382 None 11

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 45533364)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 45382596
GRCz11 17 45365848
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAAACAGGCTAAAGAAGAGCAAGAAAATATAAGAAAGTGGCAGGAACTT[C/T]GAACAAGAAATATGATGTATCAGCCCTGTGGCCCTTGGGACCGGCCATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36514
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112075 Nonsense 133 1636 4 21
ENSDART00000132969 None None 382 None 11

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 45533344)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 45382576
GRCz11 17 45365828
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAGAAAATATAAGAAAGTGGCAGGAACTTCGAACAAGAAATATGATGTA[T/A]CAGCCCTGTGGCCCTTGGGACCGGCCATATTCTAACTTTCCGCAGATGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36513
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112075 Nonsense 430 1636 4 21
ENSDART00000132969 None None 382 None 11
Genomic Location (Zv9):
Chromosome 17 (position 45532455)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 45381687
GRCz11 17 45364939
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGTTAGCTCTAAAAGTTCTAAGCATTCACATTCAAGCTCAGAAATCCCA[C/T]AACATGGTTCGTCCAGTGCACAGCAAGACAGACTGCTTTCGGAGATGCTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19187
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112075 Nonsense 631 1636 4 21
ENSDART00000132969 None None 382 None 11
Genomic Location (Zv9):
Chromosome 17 (position 45531851)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 45381083
GRCz11 17 45364335
KASP Assay ID:
2261-1525.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAACCGCCATATGGGCACCAAAGTCAAAGCAGCATCTCATGAACCCAACT[T/G]AAATAATGCCAGACGTGTTAGGAACGTGAGTGACATGCGAAAGAATGAGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3987
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112075 Essential Splice Site 1009 1636 9 21
ENSDART00000132969 None None 382 None 11
Genomic Location (Zv9):
Chromosome 17 (position 45530116)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 45379348
GRCz11 17 45362600
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTCAAAGCACCGCTTCTGTCCAAATGACGTTTGCAGCATGTCAAACAGG[T/C]AAGTTCCAATCACAGAATGGCAGTTTTAAAAGTAGTANTTGCTAACAGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36512
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112075 Nonsense 1157 1636 10 21
ENSDART00000132969 None None 382 None 11
Genomic Location (Zv9):
Chromosome 17 (position 45529587)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 45378819
GRCz11 17 45362071
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAAGAAGGATAAGAATGAGGAGATGGTAGTGACTGAAGCTTCAAAGCCA[C/T]AACCACAGGGAATAAAGCTCGCCAAACCACCGTTGAATGAAGCCAATTCT
Associated Phenotype:
Not determined