Busch Lab

ZMP

rgs7

Ensembl ID:
ENSDARG00000016584
ZFIN ID:
ZDB-GENE-040718-276
Description:
regulator of G-protein signaling 7 [Source:RefSeq peptide;Acc:NP_001002541]
Human Orthologue:
RGS7
Human Description:
regulator of G-protein signaling 7 [Source:HGNC Symbol;Acc:10003]
Mouse Orthologue:
Rgs7
Mouse Description:
regulator of G protein signaling 7 Gene [Source:MGI Symbol;Acc:MGI:1346089]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa32144 Nonsense Available for shipment Available now
sa18359 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32144
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044993 Nonsense 286 459 13 18
ENSDART00000104895 Nonsense 286 459 13 18
ENSDART00000131863 Nonsense 286 459 13 18
Genomic Location (Zv9):
Chromosome 17 (position 19550177)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 19700188
GRCz11 17 19720024
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCTCTTTAATCCGTTTGTTTTTATGATTGTGTTGTAGTTTGCTGAGCTA[T/A]GCAGAGCAGTATTCAGACTATGACCCTTTCTTGTCCACTCCTGATCCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18359
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044993 Nonsense 338 459 14 18
ENSDART00000104895 Nonsense 338 459 14 18
ENSDART00000131863 Nonsense 338 459 14 18
Genomic Location (Zv9):
Chromosome 17 (position 19550782)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 19700793
GRCz11 17 19720629
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
RCCTGGTCAGACTCGWGTTAGACGCTGGGGTTTTGGGATTGATGAGGTGT[T/A]GAAAGATCCGGTYGGGAGRGAGCAGTTTCTCAAGTTCCTAGAGTCTGAAT
Associated Phenotype:
Not determined