Busch Lab

ZMP

heatr7a

Ensembl ID:
ENSDARG00000016573
ZFIN ID:
ZDB-GENE-090806-2
Human Orthologue:
HEATR7A
Human Description:
HEAT repeat containing 7A [Source:HGNC Symbol;Acc:26958]
Mouse Orthologue:
Heatr7a
Mouse Description:
HEAT repeat containing 7A Gene [Source:MGI Symbol;Acc:MGI:2442558]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa42758 Nonsense Mutation detected in F1 DNA Not yet available
sa22879 Essential Splice Site Available for shipment Available now
sa42757 Nonsense Mutation detected in F1 DNA Not yet available
sa22878 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4668
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018091 Essential Splice Site 59 1651 2 42
ENSDART00000136648 Essential Splice Site 59 615 2 17
ENSDART00000142638 None None 731 None 17
Genomic Location (Zv9):
Chromosome 16 (position 33642181)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 31380081
GRCz11 16 31338008
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGATAAAGTCYTGTCTATGTGYCAGGATTACCTGCTCAAACACCCRAAGG[T/C]TAGCCAAAGAATTTSCTTAAAACATCTGAGCTAGTNNNTGAAGACCCTTCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7796
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018091 Nonsense 318 1651 8 42
ENSDART00000136648 Nonsense 318 615 8 17
ENSDART00000142638 None None 731 None 17
Genomic Location (Zv9):
Chromosome 16 (position 33627319)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 31365219
GRCz11 16 31323146
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCAGTCGAGTGCTGGAGACTCAGAYTGATGGACTGTTACTCGCTCTGCAC[C/T]AGCAGGTWAGTGTCTCCTCTCACTCGCTCTTTATGYGCTTCACCTTTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42758
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018091 Nonsense 321 1651 9 42
ENSDART00000136648 Nonsense 321 615 9 17
ENSDART00000142638 None None 731 None 17
Genomic Location (Zv9):
Chromosome 16 (position 33623362)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 31361262
GRCz11 16 31319189
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTATTGTCAGTTGACTTACATTGGTCTTTTTTTCCCCCATGCAGGTATG[T/A]TCACCTGTGGACTTCAGCAACCCTCCAACTATAAAAAATCACAACGAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22879
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018091 Essential Splice Site 384 1651 10 42
ENSDART00000136648 Essential Splice Site 384 615 10 17
ENSDART00000142638 None None 731 None 17
Genomic Location (Zv9):
Chromosome 16 (position 33621385)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 31359285
GRCz11 16 31317212
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACCGAATGGGCTCGCTGGCGGTTCTCAGACACCTCATCAACTCTTCCAG[T/C]GAGTTTTTACACATTATCAAATATGTCACCAATGCTCTGATCCAGGCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42757
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018091 Nonsense 533 1651 14 42
ENSDART00000136648 Nonsense 533 615 14 17
ENSDART00000142638 None None 731 None 17
Genomic Location (Zv9):
Chromosome 16 (position 33610800)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 31348700
GRCz11 16 31306627
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATAAGAAGCGAGCGACACAAGAACCCAACTTTATGATCGACTTCAATGCA[C/T]AAGGTGTGGAAACAAACACACATTCACATGCACACACATTTATAGTTTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22878
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018091 Nonsense 1173 1651 32 42
ENSDART00000136648 None None 615 None 17
ENSDART00000142638 Nonsense 253 731 7 17
Genomic Location (Zv9):
Chromosome 16 (position 33578450)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 31316350
GRCz11 16 31274277
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGAGCTGTGAGATGTGGATGGCTCTGGGAGCGGACAGCACTCTGGCCCTA[C/T]AAATCATGGAGATGATTATCGAGAAGCTCAATGTCATGGTTCCCTATGTA
Associated Phenotype:
Not determined