Busch Lab

ZMP

im:7145503

Ensembl ID:
ENSDARG00000016491
ZFIN ID:
ZDB-GENE-050309-54
Description:
Im:7145503 protein [Source:UniProtKB/TrEMBL;Acc:Q58EC3]
Human Orthologue:
AGL
Human Description:
amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase [Source:HGNC Symbol;Acc:321]
Mouse Orthologue:
Agl
Mouse Description:
amylo-1,6-glucosidase, 4-alpha-glucanotransferase Gene [Source:MGI Symbol;Acc:MGI:1924809]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa16837 Nonsense Available for shipment Available now
sa44164 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa13067 Nonsense Available for shipment Available now
sa6777 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa16837
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021110 Nonsense 357 998 8 22
Genomic Location (Zv9):
Chromosome 24 (position 30578534)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 29818775
GRCz11 24 29806926
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CYGGAAGTCTGACTGACAGCAASGTCGCTGGCAWCCTGAAAATATCTTTA[G/T]AATTGTGAGTCANTTTTTTTACCTCTATTTTGTCTGTTATTCACAAAGCG
Long Flanking Sequence:
AGAACACAGCACACTTGTTAGATTGATGCAGACATTGAAATGTACTGTAAAGAGGCCTCTATCTCACTCATGGCGTGTCCTCTCAAGTGGTGGAAAGACAATGCACAGCGTTACCCACTGCGGTCAACCTTGGCTAAATCATATCTTTCTGTCCCAGATACCTCAGTCCCAAATGAGAGTTTTTTTTCTATTAGAAATTAGTTATTAAACCTATTATGACTAGAAATGAAATGGAAAAAGTCTCGCCTCCTTTAAGCAGAAATTGGGGGAAAAATATTTTAAAAATTAAGAATTTGTTTCTTTAAAACCACATTAAGGCATATAGAGTGCATTTTGTTTAGCAAATTTCAACTTGTAACTGATCTCACAGGGTGAGCCTTGATCCAAACTCTCAGAAAATGGTGGGCTACTTGCGAACACAGCTCTCACAGTTCAACCGGCTGTTCAAATCTGGAAGTCTGACTGACAGCAAGGTCGCTGGCATCCTGAAAATATCTTTA[G/T]AATTGTGAGTCATTTTTTTTACCTCTATTTTGTCTGTTATTCACAAAGCGAAACACCAACTGTGCTGTTGCTGCATTTAGTTCTCTCACTTAAGGCCTGTTGCTTTTAATTATATTGCAGTTTAATATCCAAACTGACTCTGGCGGAGCTCAATGTGTTGTTATTTCGTTGTGATGCTGAGGAACAGGAAGACGGTGGTGGCTGCTATAATATTCCCTCCTGGATGCCTCTGAAGTATGGAGGCCTGCAAGGTACCAAAATACCCACATTATATTATTGATATTTGGTCACTGTTGTGAAATAAACATGTGCCTCCGTTATGAACAGGTTTTGTGTCTGTATTGTCTGAGATTCGACCCAAAAATGACCTTGGACATCCGTTCTGTGACAATCTAAGACAAGGAGATTGGATACTTGATTACGTGAGCACTCGTCTGATCAATAAAGGCGGAGCTCTGCGGGAGGTAGGAAACAATGTTTTGGTAATTGCCATTTGCTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44164
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021110 Essential Splice Site 358 998 8 22
Genomic Location (Zv9):
Chromosome 24 (position 30578540)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 29818769
GRCz11 24 29806920
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCTGACTGACAGCAAGGTCGCTGGCATCCTGAAAATATCTTTAGAATTG[T/C]GAGTCATTTTTTTTACCTCTATTTTGTCTGTTATTCACAAAGCGAAACAC
Long Flanking Sequence:
CAGCACACTTGTTAGATTGATGCAGACATTGAAATGTACTGTAAAGAGGCCTCTATCTCACTCATGGCGTGTCCTCTCAAGTGGTGGAAAGACAATGCACAGCGTTACCCACTGCGGTCAACCTTGGCTAAATCATATCTTTCTGTCCCAGATACCTCAGTCCCAAATGAGAGTTTTTTTTCTATTAGAAATTAGTTATTAAACCTATTATGACTAGAAATGAAATGGAAAAAGTCTCGCCTCCTTTAAGCAGAAATTGGGGGAAAAATATTTTAAAAATTAAGAATTTGTTTCTTTAAAACCACATTAAGGCATATAGAGTGCATTTTGTTTAGCAAATTTCAACTTGTAACTGATCTCACAGGGTGAGCCTTGATCCAAACTCTCAGAAAATGGTGGGCTACTTGCGAACACAGCTCTCACAGTTCAACCGGCTGTTCAAATCTGGAAGTCTGACTGACAGCAAGGTCGCTGGCATCCTGAAAATATCTTTAGAATTG[T/C]GAGTCATTTTTTTTACCTCTATTTTGTCTGTTATTCACAAAGCGAAACACCAACTGTGCTGTTGCTGCATTTAGTTCTCTCACTTAAGGCCTGTTGCTTTTAATTATATTGCAGTTTAATATCCAAACTGACTCTGGCGGAGCTCAATGTGTTGTTATTTCGTTGTGATGCTGAGGAACAGGAAGACGGTGGTGGCTGCTATAATATTCCCTCCTGGATGCCTCTGAAGTATGGAGGCCTGCAAGGTACCAAAATACCCACATTATATTATTGATATTTGGTCACTGTTGTGAAATAAACATGTGCCTCCGTTATGAACAGGTTTTGTGTCTGTATTGTCTGAGATTCGACCCAAAAATGACCTTGGACATCCGTTCTGTGACAATCTAAGACAAGGAGATTGGATACTTGATTACGTGAGCACTCGTCTGATCAATAAAGGCGGAGCTCTGCGGGAGGTAGGAAACAATGTTTTGGTAATTGCCATTTGCTAACATTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13067
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021110 Nonsense 498 998 12 22
Genomic Location (Zv9):
Chromosome 24 (position 30580703)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 29816606
GRCz11 24 29804757
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
YATATTTTTTAAAATGTGKRTAATGTCTTCCAGCTTTGTTCTGAATGGGT[C/A]GACCCTGGTCAAACAGCTGGCCCTGGGGTCAGTTCAGATGTGTGGGGTGG
Long Flanking Sequence:
GTCAGTCAGTCGACAGCGGCCTCTGGTGGATCTACGCGAGAAGAGCAGGCATAAATGGCATTCACGAGAAAAAATTTAGATCTCAGAAAGCGTACACAGTGCCCTCTGGTGGATTCATGAAAACAAAAACTGCAAAAAAAAAAAAAAAAGTACCTTCTAGGATGTATTTGGCATATTTGCTGATCTCCAATAATTGAATCAGTGAGCCTGCTTTGTACATTTATTATTGAATTTTTTTTTCTCTTCTGATTTTTGATAGGTTGGAAAATGGTTCAAAGCTGTATTTTCATACCTCAAGCATCTTCCACGCTACTTAGTGCCATGTTATTTCGATGCCATTATTGTTGGAGCGTACGCCACAGCTGTAGATGCCGTCTTCAACCAAATGTCAAGGTTAGCTTTTTTTTCTTTGTAATACAGATGTTTATTAGTTTGAGAGTGCTATTAATATATATTTTTTAAAATGTGGATAATGTCTTCCAGCTTTGTTCTGAATGGGT[C/A]GACCCTGGTCAAACAGCTGGCCCTGGGGTCAGTTCAGATGTGTGGGGTGGGTCGTGTCCCCGCCCTGCCACATCTGTCCCCTGAACTGGAGGATGTCCCGGTGCGAGTTAACAGTGCAACCAAGCAGGAGGAGCAGTGCTGTGTGTCTATTGCGGCAGGTTAGATTCATACACATTTTCATCTATTATAAAACTCCACTGTAAAAACTAATTATTTACTTTACTTGGAAAAATAAGAATAAACCTGTTGCCTTAAAAGCGACAAGTTGAGTTTACTTTTAATAATTGACTTGACCTATTGTCACTTTGGACTTTTAAGTTGATTTTGTTACTAAATGAAAACAACAGTTCTGAACTCGTCTCCTTTATTGCATGACCACCATGGCCCTTCACTAACAACAACAAAAACTCCCACTCACACCGGAAGTGACCTTTTAACTTAACATAAAAGTCCTACTTTCTTTCTATGTGCAGCATACACATTTACGGTTGTCATCACCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8041
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021110 Nonsense 774 998 17 22
Genomic Location (Zv9):
Chromosome 24 (position 30589351)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 29807958
GRCz11 24 29796109
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCAGCGGTGCGCTGGCTGATGATGATGAATGAGACTGGACATTTTCCATA[T/A]TCCTCTGTCAAAATWCACAGAGATGGTACGTCAATCTGTAGCACATCCTC
Long Flanking Sequence:
GGTCCGCAGATCGACTGGAACATGCAGCATGAAGGTGTGACGTCTTTCCACGAATGCACACTGGAGATCCTATTTCCAAGTCTGTGGCAAACCTTTTCTTTTCCTGTTATCCTGCCCCATAGGCTTTAACGTGGAGGCCAAAGTAAATCCCGAGACGGGCTTTGTTTACGGTGGAAATGGCTTCAACTGTGGGACATGGATGGATAAAATGGGAGAGAGCGATAAAGCCCATAATAAAGGTGTTCCAGCCACACCCAGGTACTAAAGATTCCCACTGTCATACATGACATGCTAAACCCCTGTAATAATAACCCGCTATATTTAGCCCAAAAGAATGCTTTGAGGAATAAGCACTGAGGCTCCGTAGATAAACCAGTCTTCTTTGTGTCAGGTGATGTGTTTTTGTTGTGCAGGGACGGCTCTGCGGTGGAGATTGTTGGTCTTAGTAAGTCAGCGGTGCGCTGGCTGATGATGATGAATGAGACTGGACATTTTCCATA[T/A]TCCTCTGTCAAAATACACAGAGATGGTACGTCAATCTGTAGCACATCCTCATTCTTCAGGAACATTTCAGCGGTTCACTATTTCTACTTTTTTATTGTTTTATTTTTTTATATGAATTTTATACAAACTGTGATTTTAAAATAAGGCATCATTATTAATAATGCAATTATTTGTTTTAAAATAAGGTTCCAGCAATTAAATAAGGTGCTTGGTTTATTTATTCACTTCTGTCATGAACTCTCTCAGAATTAAATATGGTAATGATTATGTGTGTGGCAATGTTAATGTATTTAGTCTTGACGCAATAAATCTGCTACACTGCTGCTGCTGCTGCTTTGCTTATTATGGCAAAACAAGCAACAAGACGTACTATTGCCAGTATATACCAAAGTCCCTTTAATGCAAGTCATTTCATTTGGTGGCCTTAGAGACACCTCATGGGCAGTATGCTCAGGCATTCTGTCTGAAAGGGAAACATCAAATTCTTCGAAACTGTTTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6777
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021110 Essential Splice Site 960 998 21 22
Genomic Location (Zv9):
Chromosome 24 (position 30597005)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 29800304
GRCz11 24 29788455
KASP Assay ID:
554-5328.1 (used for ordering genotyping assays)
KASP Sequence:
GTGTWCCTGGTCAAGAATGTTCTGTCTAGACTTCACACCCATTTAGAAAG[G/T]TATTACCAAACAAAACAAAWCCAAAAAGTGGGTCAGATCGTGTGTTTTTT
Long Flanking Sequence:
ACAATCATAAGCATAGGATCCTCTCAAAATTTGTTTATAAATAAACTTCACTTCATAAGACCTTTAAGTTGCAAAAACAACATCTATGATTTTACTTGGCATGATAAATATCACAGATCACTTTGGAAAAGTTCCCATGTAGAATAGTTTCCATGTAGAAGTGTTTGATTTATGTGTCTCTGTGTTTGTCTAACAGTGATCTGGTGTACTGTGGTGTGTATGACAACGCCCTGGACAATGATGACTACAACCGTGCAAAAGGATTCAATTATCACCAAGGACCTGTATGTGTTTATACACTGACATCAATACATTGCTTTGGATGTAATAGATTTGTAATACATGCATAATTAAATTTGTTTGCAGGAATGGATTTGGCTGGTTGGATACTTCTTAAGAGCCAAACTTTATTTTGGAAGGAAAATGGGCCAAGAGAAGTACAATCAAAGCGTGTTCCTGGTCAAGAATGTTCTGTCTAGACTTCACACCCATTTAGAAAG[G/T]TATTACCAAACAAAACAAAACCAAAAAGTGGGTCAGATCGTGTGTTTTTTTTTTTTTTTTTAACAAAATGTAAGGCAGAGGTGTCAAACTCAGTTTCTCTCCACTAACAATTAAACACCTGATCCAACTACATCCTTCAGGCGTATATTTGAGCTACATTGTGTGTTGGGGCAGGGTTGGAACTAAACTCAAAGTTTGACACTCCTGCTCTAGTGTCAGGTGTTCTTAGAATGTGTCTGTGAACTTTCAGCTCAAAATATCTCAGATCATTTATTATAACCTGCTGTAAATGTCATTTGGGGGGGGGGGGATGCTTTTTTTAAAGATTTTCTCAAAAATATGAATGATAGTCAAACTTAGGCCCATAAATATTTGTTAAAATTATGGATTCGCTCATTCATTTTCTTTTCGGCTTAGTCCCTTTATTAATCTGGGGTCGCCACCGCGGAATGAACTGCCGATTTATCCAGCATATGTTTTACGCAATACACTACGGACAA
Associated Phenotype:
Not determined