Busch Lab

ZMP

ptpn2a

Ensembl ID:
ENSDARG00000016481
ZFIN ID:
ZDB-GENE-040426-1196
Description:
protein tyrosine phosphatase, non-receptor type 2, a [Source:RefSeq peptide;Acc:NP_956760]
Human Orthologue:
PTPN2
Human Description:
protein tyrosine phosphatase, non-receptor type 2 [Source:HGNC Symbol;Acc:9650]
Mouse Orthologue:
Ptpn2
Mouse Description:
protein tyrosine phosphatase, non-receptor type 2 Gene [Source:MGI Symbol;Acc:MGI:97806]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa22765 Essential Splice Site Available for shipment Available now
sa42667 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa32072 Essential Splice Site Available for shipment Available now
sa16594 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22765
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104037 None None 389 1 10
ENSDART00000130382 Essential Splice Site None 272 None 8
ENSDART00000136168 None None 392 1 9

The following transcripts of ENSDARG00000016481 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 11665845)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 10180895
GRCz11 16 10071797
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAGAGGAAAACATTGCGTAACACCGTTTCTCTTTGTTTTCTCCAGAGAG[T/C]TATGTCAATTTCAAACAATGGAATAGCAATAACTCATTTGATATGAGACA
Long Flanking Sequence:
ATGAAAAGAAAAACAATAAAACATGTCATGCACACAAATTTGATCACAGGTAGAGATGTACACAATTTTTTTAATTTTATGCTTCAGACAATGCATATGCTATAGTGTGTCTATCATTACAATACACCAATAACTTTATAACTCATGAAATGCTATTAAATAAGTTCTATTTCAGAGTAGGAATTTTCGGCTCATCAAATTTTTTTTAATGAATTTTTTTAGTCATATGTATTTCCCAGAATAAAAAAATATATATAAATACATTTAGATTATTTACTTTAATCATTTCTTTTGGAATGTGAAGAAACTTTCAACCAACATAAAATAGTTTCTGAAGACAATCACCTACTGCACCTTTAAGAGCAATTAGAACGTAACGTAAAAAACCAGAAGATGGCAGTAATGCAGCGCAAAGGATGCAAGCTGCCGGTAAAATCAGAAGAAGAAGAAAAAGAGGAAAACATTGCGTAACACCGTTTCTCTTTGTTTTCTCCAGAGAG[T/C]TATGTCAATTTCAAACAATGGAATAGCAATAACTCATTTGATATGAGACAACAATTGATTTACCCGCTTACGTGTGAATGATCTCTCTTTAGAAAATAAAAATGGACCAGGAGTTTAAGAACATCGATTCATCTGGAGAGTGGCAAAACCTTTATAATGTGAGTTATAACAAACAATAACAAAATAATAACAAAAACACTAGATGGTTTATAGTAGGCACACTTAAAACATCAGCTGTGCTCTCCCCTGACATTTTGCTATGTTTTAAAATAGTAAATCATATAGGCATCTCGGCCCCACTGGAACAACCATACTTAAAAGTTTGCAAAATGTTAAGATATTCAGTTGAATTCATTTATTTCTATAGCACTTTTACGACGTAGATTTTGTCAGTGATGAAGAGAAAAAAGAGAGTAAAAGCCATATTTAAAATTGTGGAACATTGAAGTAATTTAGGCAGACAGGATAGTGTTGCCATAGAGGTAAAGTTGGTTTTATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42667
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104037 Essential Splice Site 20 389 2 10
ENSDART00000130382 Essential Splice Site 20 272 3 8
ENSDART00000136168 Essential Splice Site 20 392 2 9

The following transcripts of ENSDARG00000016481 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 11664765)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 10179815
GRCz11 16 10070717
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTAGTTTTTTTAAACACGTTTTAATCAAATGTTTTTGTAACCCTCTTTCT[A/C]GGAATTACATAATCAGTCTCAAGAGCGGTCCTACAAAGTGGCAAAGTTCC
Long Flanking Sequence:
TAAGTATGACTTCAAAAAAACACTGACACAATTGAATTGACTAAACAATGTTGTACTTGGATATTCATTGGCTGCTAATATGAAATCGCTATTTAGAATTTAAAAGAACACTTTCTGAAATGATAAATCATCCTAATAATTAGGGAGAAAGTCTGAATGTCCAAATATAAAACTAACTTTACCCAGATTTACCACATTGCACATTCGTTCATTTTTAAACAGTGACAACTAACTCTATTATAAGCTTATGTGAATCATATCAACATGTAACATGAGTGGAAATATTTTTTTCAAGAATACTAAATTCCGTTTTTAGATATTTTCAGTCATTTTCTGAACACGTGGGCTATGTTGTTTCCAAGTCACATTCTCACTCTCTTCTTTTTATATAGTATTATATATTTTGTGGTATTTTGTTATGCTTTACAATATGATCATATATTAATAAATGTAGTTTTTTTAAACACGTTTTAATCAAATGTTTTTGTAACCCTCTTTCT[A/C]GGAATTACATAATCAGTCTCAAGAGCGGTCCTACAAAGTGGCAAAGTTCCCAGAAAACTGCAATAGGAATAGATATAGAGACGTCAGTCCTTGTAAGTTTCATCTATTTACAAATGTTGCAGTAGTCAACATTTAAAGTGGTTTAAAGTGCTGTTATTGCATAATTTATAGTGATATATACATTTAATTAATTATAGATAAATAAGTATTGATATATTGCATATTATTGTAATGTTACAATAGCACACAATATCTATATTTATTAATTTATTGATGTTGTTTTTGTTTAACTAAGCACATTTAGTTTTAGGTCAATTTTTGATTAAATGTTTTGATCCACTGCAAATGTTGACTACTATTTTTTTTAACAGTGTTTCACTCATCTTGTAACCTAGATGAAAAGAATTGTTAAGCAGAATAATATCTCAAGATGTTAACTTTCATTGTATCAAAATGTACAGCAGTAAAAACTTTTGGGGATTTTTGTGTACTATGAAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32072
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104037 Essential Splice Site 84 389 4 10
ENSDART00000130382 Essential Splice Site 84 272 5 8
ENSDART00000136168 Essential Splice Site 84 392 4 9

The following transcripts of ENSDARG00000016481 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 11662226)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 10177276
GRCz11 16 10068178
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATTGAAATTGTTTGCATGTTCAGTTATGCATATACTTTCCTCTATCTGC[A/T]GGGTCCCTTGAAGAACACTTGCGGTCACTTCTGGCTAATGGTTTGGGAAC
Long Flanking Sequence:
GTTTGATGGTAAGAAACTACAAGATTCACATTTACACGTTTACTGTTTGTACTAATAGGTACAATACAATTGTACAATTGGTCTAATAGGGTTGAGCTTATTCTCTTAATGAGTTATAGGTGTGTTTTGAGAATAAACCAATCAGAGTCTCATCTTCCATTCCCTTTAAGCGTCAGTTGCATCGCACCATAGCGCATTTGCTATTTATTTATTTATTTACTATTTGCTATTTACACGACAGACTTTGTAAGTTTAAAAACTGAGCGTTTCACTAGCAAGAAAACAGTCAAACAGAGCATCTGCAGCACGAGAATGAGAGATAAGGCCTCCTCATTATTTACTTTTACTTTCACTCTCATGGATAGGGAAACTTCTCGTATGCACAGACATCCTAAGTTGGGGGTGCTATTTGACTGGATTTTATGAACATTGCTTTTGCTTATATCATCTTATTGAAATTGTTTGCATGTTCAGTTATGCATATACTTTCCTCTATCTGC[A/T]GGGTCCCTTGAAGAACACTTGCGGTCACTTCTGGCTAATGGTTTGGGAACAGGGTTCCAAAGCAGTTATTATGCTTAACAGAGTGATAGAGAAAGGCACGGTGAGTCACATTTTATATTTTCTTTGCTTTGCTTTATTTTAATTTATAAAAATTGCAAATGTTTTTGATTATATAAGCATTTCAAGAAATTTGAAAATGACCACTAGCCCCGTCACATGGCAAAGACATTAAGACAAAAAAATAGGCTTTGTCTTTTTGTGTAAGGCAAAATGTTTTGTGTAACAGCCATTTGTAAAACTACTGCCAAGTGTTCGGAAGGAATGGGATGCAAACGGACATGCTTTTACTTGAGACATTTGTTAATGGAAAACATAATTTCTTCATTAATCATTATAAATTTGTTGACAAGCTTTATTATCATTGTAAATGCTAACTTTTTTTTAAATAAAAATTTTGGAAATCAAAAATAAATAATTATTACTATTTTAAAAGAACTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16594
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104037 Nonsense 110 389 4 10
ENSDART00000130382 Nonsense 110 272 5 8
ENSDART00000136168 Nonsense 110 392 4 9

The following transcripts of ENSDARG00000016481 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 11662146)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 10177196
GRCz11 16 10068098
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCTGGCTAATGGTTTGGGAACAGSGTTCCAAAKCAGTTATTATKCTTAAC[A/T]GASTGATAGAGAAAGGCACRGTGAGTCACATTTTATATTTTCTTTGCTTT
Long Flanking Sequence:
GTCTAATAGGGTTGAGCTTATTCTCTTAATGAGTTATAGGTGTGTTTTGAGAATAAACCAATCAGAGTCTCATCTTCCATTCCCTTTAAGCGTCAGTTGCATCGCACCATAGCGCATTTGCTATTTATTTATTTATTTACTATTTGCTATTTACACGACAGACTTTGTAAGTTTAAAAACTGAGCGTTTCACTAGCAAGAAAACAGTCAAACAGAGCATCTGCAGCACGAGAATGAGAGATAAGGCCTCCTCATTATTTACTTTTACTTTCACTCTCATGGATAGGGAAACTTCTCGTATGCACAGACATCCTAAGTTGGGGGTGCTATTTGACTGGATTTTATGAACATTGCTTTTGCTTATATCATCTTATTGAAATTGTTTGCATGTTCAGTTATGCATATACTTTCCTCTATCTGCAGGGTCCCTTGAAGAACACTTGCGGTCACTTCTGGCTAATGGTTTGGGAACAGGGTTCCAAAGCAGTTATTATGCTTAAC[A/T]GAGTGATAGAGAAAGGCACGGTGAGTCACATTTTATATTTTCTTTGCTTTGCTTTATTTTAATTTATAAAAATTGCAAATGTTTTTGATTATATAAGCATTTCAAGAAATTTGAAAATGACCACTAGCCCCGTCACATGGCAAAGACATTAAGACAAAAAAATAGGCTTTGTCTTTTTGTGTAAGGCAAAATGTTTTGTGTAACAGCCATTTGTAAAACTACTGCCAAGTGTTCGGAAGGAATGGGATGCAAACGGACATGCTTTTACTTGAGACATTTGTTAATGGAAAACATAATTTCTTCATTAATCATTATAAATTTGTTGACAAGCTTTATTATCATTGTAAATGCTAACTTTTTTTTAAATAAAAATTTTGGAAATCAAAAATAAATAATTATTACTATTTTAAAAGAACTAAATAGGTCCATAAATATTAGGACATCAAGACAATTCTAACATTTTTAGCTCTATACACCAACACAATGGATTTGAGATTAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5618
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104037 Nonsense 315 389 8 10
ENSDART00000130382 None None 272 None 8
ENSDART00000136168 Nonsense 315 392 8 9
ENSDART00000104037 Nonsense 315 389 8 10
ENSDART00000130382 None None 272 None 8
ENSDART00000136168 Nonsense 315 392 8 9

The following transcripts of ENSDARG00000016481 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 11652884)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 10167934
GRCz11 16 10058836
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AATCTGACCGTATGGAACCACAGGATTCAGGACTAGAGCAAGAATGGAAA[C/T]GATTTCCAAAGGAAGAGCAGCTTAGTGAGTTAAAAACATTCAGGTAAGAG
Long Flanking Sequence:
AATTCAAGACTTTCGGCATTGATTTTGTTCCATAGGGGAGTGGCTTTCTAACCCAGTGAAGCTGAAATCTACTCGCGTGTTCCAGGTTGGCAGGTGTTAATGTCAAGCCCTGTATACTAGTATATATTTTACTCTATATAGTACTCAAAGCTTTGGACACATGAATATTTAAATGTCCTTTTGACTGGTACTGTACTATAATATGCATAAAAAATATTGGCCAATATTTCTGTATCTGTATTGTTTTACATCCTAATGGCATCTGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACCATATTGGTTAGACTCTAAAAAAAAACTGGATATGCCGGGGTTCTTTTTTTACTGAAAACAGAAGCTGCCTAAAAATGCCAGGATCCAAATGTTTATTTGGTTTCATCTTTTTAGAGCTCGATCTTGAGTCCTGAGAATTACATTGGAGAATCTGACCGTATGGAACCACAGGATTCAGGACTAGAGCAAGAATGGAAA[C/T]GATTTCCAAAGGAAGAGCAGCTTAGTGAGTTAAAAACATTCAGGTAAGAGGATGGAATAATGGAAAAGTTTTTTTTTTTTTTTTTTTTGCAATAATAGTAAATTTAAAATCAGTTTGTTGTTATTTTGTCTACTTCTATCAGCTAAGATTGTAGTGTCAAAATAAATTACATTTAGTTGTTAGTAGGCTTTATTTTTGTTTATATGGAAATATAATTTTTTCAGCAAGCGTGCATTAAATGGCTTATATGCAAAGCTAGGGTTTTCCGCCAATGATGAACTACCGGTGAAAGCTTTATGTGACTATTTTTAATTTTATAAGGTTCCTTTTACAGCATCGATGTTGTAATGTAATTCAAATATACTCAGTTAAATAAAATTAAGCATCTATTTGATTGTTGAAATGTAAAAAGAGACGAAAGACCATTTAAATTCAGGTGCTGTCATTAGCCGCAGGCTAGCGCAGAAATTCCAATGAAAATACTGGGGTAAAATAAATTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3968
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104037 Nonsense 315 389 8 10
ENSDART00000130382 None None 272 None 8
ENSDART00000136168 Nonsense 315 392 8 9
ENSDART00000104037 Nonsense 315 389 8 10
ENSDART00000130382 None None 272 None 8
ENSDART00000136168 Nonsense 315 392 8 9

The following transcripts of ENSDARG00000016481 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 11652884)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 10167934
GRCz11 16 10058836
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AATCTGACCGTATGGAACCACAGGATTCAGGACTAGAGCAAGAATGGAAA[C/T]GATTTCCAAAGGAAGAGCAGCTTAGTGAGTTAAAAACATTCAGGTAAGAG
Long Flanking Sequence:
AATTCAAGACTTTCGGCATTGATTTTGTTCCATAGGGGAGTGGCTTTCTAACCCAGTGAAGCTGAAATCTACTCGCGTGTTCCAGGTTGGCAGGTGTTAATGTCAAGCCCTGTATACTAGTATATATTTTACTCTATATAGTACTCAAAGCTTTGGACACATGAATATTTAAATGTCCTTTTGACTGGTACTGTACTATAATATGCATAAAAAATATTGGCCAATATTTCTGTATCTGTATTGTTTTACATCCTAATGGCATCTGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACCATATTGGTTAGACTCTAAAAAAAAACTGGATATGCCGGGGTTCTTTTTTTACTGAAAACAGAAGCTGCCTAAAAATGCCAGGATCCAAATGTTTATTTGGTTTCATCTTTTTAGAGCTCGATCTTGAGTCCTGAGAATTACATTGGAGAATCTGACCGTATGGAACCACAGGATTCAGGACTAGAGCAAGAATGGAAA[C/T]GATTTCCAAAGGAAGAGCAGCTTAGTGAGTTAAAAACATTCAGGTAAGAGGATGGAATAATGGAAAAGTTTTTTTTTTTTTTTTTTTTGCAATAATAGTAAATTTAAAATCAGTTTGTTGTTATTTTGTCTACTTCTATCAGCTAAGATTGTAGTGTCAAAATAAATTACATTTAGTTGTTAGTAGGCTTTATTTTTGTTTATATGGAAATATAATTTTTTCAGCAAGCGTGCATTAAATGGCTTATATGCAAAGCTAGGGTTTTCCGCCAATGATGAACTACCGGTGAAAGCTTTATGTGACTATTTTTAATTTTATAAGGTTCCTTTTACAGCATCGATGTTGTAATGTAATTCAAATATACTCAGTTAAATAAAATTAAGCATCTATTTGATTGTTGAAATGTAAAAAGAGACGAAAGACCATTTAAATTCAGGTGCTGTCATTAGCCGCAGGCTAGCGCAGAAATTCCAATGAAAATACTGGGGTAAAATAAATTT
Associated Phenotype:
Not determined