Busch Lab

ZMP

irf9

Ensembl ID:
ENSDARG00000016457
ZFIN ID:
ZDB-GENE-040912-165
Description:
interferon regulatory factor 9 [Source:RefSeq peptide;Acc:NP_991273]
Human Orthologue:
IRF9
Human Description:
interferon regulatory factor 9 [Source:HGNC Symbol;Acc:6131]
Mouse Orthologue:
Irf9
Mouse Description:
interferon regulatory factor 9 Gene [Source:MGI Symbol;Acc:MGI:107587]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa17117 Nonsense Available for shipment Available now
sa6239 Nonsense Mutation detected in F1 DNA Not yet available
sa4457 Nonsense F2 line generated Not yet available

Mutation Details

Allele Name:
sa17117
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005801 Nonsense 112 394 4 10
ENSDART00000125220 Nonsense 112 280 3 10
ENSDART00000137757 Nonsense 112 428 4 10
Genomic Location (Zv9):
Chromosome 12 (position 14394092)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13249745
GRCz11 12 13288048
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGGTCACAGAAAGGTCACAGCTGGATATTTCAGAACCCTACAAGGTGTA[T/A]CGCCTTGTACCACCAGAAGAACAAGGTAGTCAACATGTGCTACACATTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6239
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005801 Nonsense 346 394 8 10
ENSDART00000125220 None None 280 8 10
ENSDART00000137757 Nonsense 346 428 8 10
Genomic Location (Zv9):
Chromosome 12 (position 14401896)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13257549
GRCz11 12 13295852
KASP Assay ID:
554-4691.1 (used for ordering genotyping assays)
KASP Sequence:
TGGAAAGATCAGGCACGCCAACCCAGCTGTTTAACCGGGAGATATTTCAA[C/T]AAGGTAAGTGTTTCACAAGCATCTACAGTATTTAGMTTTATAAAACCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4457
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005801 Nonsense 382 394 9 10
ENSDART00000125220 None None 280 9 10
ENSDART00000137757 None 381 428 9 10
Genomic Location (Zv9):
Chromosome 12 (position 14409442)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13265095
GRCz11 12 13303398
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTTTTGGAGAGGAGCTCTTGGAGGRAGATAACATCTCTGATAAACACAT[C/A]ATCATTAAGGTAAATGCGTAATTGATGTACATATATAGATCATTACTACR
Associated Phenotype:
Not determined