Busch Lab

ZMP

esr2a

Ensembl ID:
ENSDARG00000016454
ZFIN ID:
ZDB-GENE-030116-2
Description:
estrogen receptor 2a [Source:RefSeq peptide;Acc:NP_851297]
Human Orthologue:
ESR2
Human Description:
estrogen receptor 2 (ER beta) [Source:HGNC Symbol;Acc:3468]
Mouse Orthologue:
Esr2
Mouse Description:
estrogen receptor 2 (beta) Gene [Source:MGI Symbol;Acc:MGI:109392]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa37010 Essential Splice Site Available for shipment Available now
sa25133 Nonsense Mutation detected in F1 DNA Not yet available
sa16405 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37010
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010643 None None 553 None 10
ENSDART00000129589 None None 551 None 12
ENSDART00000131069 Essential Splice Site None 553 2 11
Genomic Location (Zv9):
Chromosome 20 (position 21667301)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21695468
GRCz11 20 21595141
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGTTTTATCCACTTTATCACATCATCCTTTTGTGCTTCTGTCATTCTGC[A/T]GGTGCTTGTTCTTGTTCTGTGCTCAGGGTATGTTTTGGCCGCTTGCCTGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
hu7876
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010643 None 69 553 2 10
ENSDART00000129589 Nonsense 68 551 3 12
ENSDART00000131069 None 69 553 3 11
Genomic Location (Zv9):
Chromosome 20 (position 21673383)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21701550
GRCz11 20 21601223
KASP Assay ID:
554-2416.1 (used for ordering genotyping assays)
KASP Sequence:
GACCTTGGCCACGACTTCAGCACYYTGCCCTTTKAMAGTCCCGCTCTGCT[G/A]GGGTACAGCACATCGCCTTTATCGGACTGCTCGTCTGTGCGCCAGTCGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25133
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010643 Nonsense 119 553 2 10
ENSDART00000129589 Nonsense 117 551 4 12
ENSDART00000131069 Nonsense 119 553 3 11
Genomic Location (Zv9):
Chromosome 20 (position 21673532)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21701699
GRCz11 20 21601372
KASP Assay ID:
554-7852.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTGCAACAACAGAGTCGACTTCAACAGAACCATGCTACTAGTGGGACTT[G/A]GACCGAACATACACCACATGATCATGTTGAAGAGGAAAACAGGTAGGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16405
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010643 Nonsense 411 553 7 10
ENSDART00000129589 Nonsense 409 551 9 12
ENSDART00000131069 Nonsense 411 553 8 11
Genomic Location (Zv9):
Chromosome 20 (position 21697722)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21725889
GRCz11 20 21625562
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCTTTGATATGCTGCTGGCAGCCACGTCCAGATTCAGAGAGYTGAAGTTA[C/T]AGAGAGAAGAGTACGTGTGTCTCAAAGCCATGATCCTCCTGAACTCCAGT
Associated Phenotype:
Not determined